result

Gene information

Detail information of g397809

Location

Gene	Chr	Start	End	Strand
g397809	Scaffold_76467:HRSCAF_459553	362418	364380	-

Sequences

CDS

Protein

Gene

>g397809.t1
ATGACCACTCTCGTCCCTCCGTTCATCCCATCCGTCCTTTGGAACCCTTCCTCCGAAGAGTTCATGCGCCAGTACAAGATCGTACGACAACGATGTTTGCACCGACTACGTTAGCTCCAGCACGTGATCTATGGACTCTTAGACACAAAACAACTTTAAAAGTAAGGAGCCTTGTGGTATATTTCACATATATCAGTATTAAAACTTAGTTATTTATAAATTCTGAATATTACAGGTAAATTAAATTTCAAGATCTGTGAGAGGTCTCTCAGTGGTTCTGGATGCAGTTCAAGTGTTGCTACTAGTCATCAATTCGTAAGAGCCGAAATGCTTCTAAGTGGTTTCTTGGTTCGTCTATGTGATGGTGGTGGTTCCATTGTAAACATTGTTGATCACTTAAATATAGAGGTTATAGTCTATGCTAGTATTGGTATTACTGAATAGTGAATACTACTACCTAGTTTATCTCTACACAAATATTTGCTTTTTTTAACGTGTCAGGCTGGAGTGTGCCTGAAGTTCTTAGACCTCTTTACGAGTCTTCCAGGGTTGTTGCTGAGAAAATGACTACTACAGTTAGTGTCAATATTATCGTTAACCTGTTAAATGATTAATGGCATACAGCTGAACAAGTTTTTATATTCATTGTAGGCACTGCGCCATATCAAGCAAATAGCACAAGAGATAAGCGGTGAAGTAGTGCATGCTCTTGGAAAGCAGCCTACTGTTTTGCGTACCTTCAGTCAAAATTGACCAGGTAATTTCTTGAATCTAAAAATAATAAAGGTATATATGATGATGCAAAACGATGAAGTATTTACTATCTTTGTATATTTTAGAGTTTTTAATGACGCTGTTAATGGATTCGTCGATGATGGATGGTCTGTTAGGGGAAGTGTATATGATATTGAAGATGTAACAATTGCTACAAACTCTAAGACAAAAACCCTTGATGATGTCTCAATGCCTAATGTGGTGTTTTGTGCTTCAAAATTTCAAATTAAAATTGCTTAATTTATGTACAAATATGAATTTGAAATTTGAATATCCTTTTTTGAAAATATTTCTGCGGGCATTTAAACTTTTAGCTGTATTGGCCACAACGACTAGAAGAAAAATTAGATAGAATCGAAAATATTCTCAGTTCAGCGCTTATTGATGCTCCCACTGCTAAAGGAAGAGAAATCACAACTACCATTGATCCTCTTACTTCCCATTCTTGGGAAGAGGTGTATTTTGCGAAGTATATAGCCTGAACATCAAATTATAAATCCACGAGTTATGTTTATGTGTTCAGATATCTATGAAGGATATATTGGTAACTCCAATATAATGCAAGTCGATATGGGGACAGTTTAAAACAGAAACTGAATATAAAGTTTCTCAAGCAATATCTACATAGGTACATGTACGTTTCTCCTACTCTTGTTGATATTGAAATTTACTGTATCATTATATTTCATTACAAAATGTTATGCTTTTCAGGAAGCTCATAAGCATGGTAAAAGTTGGTTACCTCCACCATGGGCAATTGCGATGATTGCAATCCTTTGGTTCAATGAAATCATGGTACTTTTGAAGTAAGTTATATTGTTATATTATTTCAAGCTTACAAGTACATAAGTGCTTATTTTACCTTCTTTTTGGTAGAAATCCTTTGTAATTGGGTGTAATTTTTGTTCTTTTTCTGATACCAAAAGCTTTGTGGGTACAATTAGGTGCTGCTGGAGAATTTCGTAATGGAACGGTAAGCAGAGTGGATAAATTCTTTTGTTTTTTTGCATAGGTTGATTATTTTCAGGACTATGCTTTATATATGCAGATGTCAGGACTTATTTCTATATCAACAAAATTGGTTCCAACAATAATGAATCTTTTAAGAGGATTAGCTGAAGCAGGGCAAGGAAGCAATGAAAGTAGTCAGCAAAAAGTTGCTTTGAGTTCAGAGAGTTATAAAAGTTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_010920419.1	1.3e-42	homeobox-leucine zipper protein HOX9 isoform X1
Swissprot	Q9AV49.1	4.0e-44	OsHox9
trEMBL	A0A8K0IDZ2	1.9e-43	Homeobox-leucine zipper protein HOX9

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G60690.1	58.86	6e-45	177	IFL;IFL1;REV	Homeobox-leucine zipper family protein / lipid-binding START domain-containing protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g397809	AT5G60690.1	158	47	4	28	176	289	437	58.86	6e-45	177
g397809	AT2G34710.1	148	49	3	28	166	302	441	55.41	1e-38	157
g397809	AT1G30490.1	151	51	3	28	169	298	440	54.97	1e-37	154

Ortholog group

Species	Genes
Allium cepa	g397809.t1; g517910.t1
Allium fistulosum	AfisC8G02489
Allium sativum	Asa1G04599.1
Arabidopsis thaliana
Oryza sativa	LOC_Os10g33960.3; LOC_Os10g33960.4

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF01852.16	START	Domain	40	114	35.6	5.4e-09

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001067	F	regulatory region nucleic acid binding
GO:0003002	P	regionalization
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007275	P	multicellular organism development
GO:0009653	P	anatomical structure morphogenesis
GO:0007389	P	pattern specification process
GO:0009888	P	tissue development
GO:0008150	P	biological_process
GO:0009798	P	axis specification
GO:0009799	P	specification of symmetry
GO:0009855	P	determination of bilateral symmetry
GO:0009889	P	regulation of biosynthetic process
GO:0009933	P	meristem structural organization
GO:0009943	P	adaxial/abaxial axis specification
GO:0009944	P	polarity specification of adaxial/abaxial axis
GO:0009955	P	adaxial/abaxial pattern specification
GO:0009956	P	radial pattern formation
GO:0009987	P	cellular process
GO:0010014	P	meristem initiation
GO:0010051	P	xylem and phloem pattern formation
GO:0010087	P	phloem or xylem histogenesis
GO:0010089	P	xylem development
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0044212	F	transcription regulatory region DNA binding
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048507	P	meristem development
GO:0048532	P	anatomical structure arrangement
GO:0048856	P	anatomical structure development
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065001	P	specification of axis polarity
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09338	HD-ZIP; homeobox-leucine zipper protein	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network