result

Gene information

Detail information of g412665

Location

Gene	Chr	Start	End	Strand
g412665	Scaffold_78255:HRSCAF_461341	136874	138079	-

Sequences

CDS

Protein

Gene

>g412665.t1
ATGTTGGATACGCCATTCAGTGCAATAACTCTAATTCAGATCGTCAGAGAAGAGGATCGAACCCGAATGGCTTCGAATTTTGCTGTTAAATACATTTTCCCTGGTTTGCGAAATTCACAAAGGTTGCACAAGTAGGAAGAACGCAGTGAATAAGTACTGCATAGATTGTAGACGCTGTTTGTGCTCGCTTTGTCTTTCTGACGATCCCTTTCACTATCGCCACAAAATACTTCAAATCCGTCGCTATGATCTTCAGGATTGCGTGAGGACTGCTGATGTTCGTCGCTTGATCGATTTCTCTGGAATTCAGGTACTAATTGGTTGATCTCAATTCGTTTTATGAAATGTTGATTATTACTTTCAATTTGGTGCAATGTGGGTTATGCAAGAGCTATTAATCTCATATAACTGTTTCTATTTCATTTAATCCTGTAATACAATGTAATTGCTTTTCATTTATTCCTGTAATACAATGTAATTGCTGAATCGTTTAGAATATTTTTAGAAGTTTGATGATTATCTTTAATGTTAGTTTTCACAGTTTAATTTGAATGAATGAGAGAAAATGTGGATTATCACTAATCACCTAATATCGTGGAATTGAGACGTTTAATTGATTAAATAACAATAAAGCAGAAGAAATTACACTCTCACGTTAATTTTCTAATATACTTGTTTACTTTACTTCTCTATCTCTACTATTAATATTGCATTCCATCTATAGTTAATAAAAAATTCTTATATTTTCAGCAATATAAAGAGCATAGTGCAAGAGTACTGCTTCTTAAGGCAAGACAACCGAGGTCATCCAAATCCACAGTGCCTCACAGATGTAGAGTCTGCCATGCATTTCTTGTTGAAGCAAATCAATACTGCTCTCTTACTTGCAAGGTAGTTTATCATATTATAAACATAATCGCTTTCAAATTTTCAAAATATAAACCTTTAAAATGGGTGATAATTAATTAGAATTTTCAGGTATCGGTTGAAAACAATTTGGATTTTTCATCACCTGGATATCAAGCTTGTTCTAAGGAACTTCTCGATGGTCCTGAACCTAACAGTGCAGTAGATAACAGTGATGATTCATCGGAACAGTCAAAGTCTTCCAGACCGTCGGATTTGGCTGAGGAGAATGAAGGCCCTTGGATGAGTTTTAGGAAAAGGAGTAGAAAAGGTGTTCCTATTAGATCTCCTAGTTATTAA

Functional annotation

Database	accession number	e-value	annotation
nr	KAF3332416.1	5.3e-11	PLATZ transcription factor
trEMBL	A0A833R316	3.8e-11	PLATZ transcription factor

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G32700.1	42.55	1e-15	79.7		PLATZ transcription factor family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g412665	AT1G32700.2	94	49	3	44	136	11	100	42.55	1e-15	79.7
g412665	AT1G32700.1	94	49	3	44	136	50	139	42.55	1e-15	79.7
g412665	AT4G17900.2	166	97	6	44	207	11	164	33.13	2e-14	75.5

Ortholog group

Species	Genes
Allium cepa	g412665.t1; g412666.t1; g412669.t1
Allium fistulosum	AfisC7G05288; AfisC7G05289; AfisC7G05290
Allium sativum	Asa4G05151.1; Asa4G05153.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF04640.11	PLATZ	Family	64	135	57.9	1.1e-15

Gene Ontology

Accession	Ontology	Name
GO:0001067	F	regulatory region nucleic acid binding
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006952	P	defense response
GO:0050832	P	defense response to fungus
GO:0005488	F	binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006950	P	response to stress
GO:0009888	P	tissue development
GO:0008150	P	biological_process
GO:0042493	P	response to drug
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0051707	P	response to other organism
GO:0009620	P	response to fungus
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010087	P	phloem or xylem histogenesis
GO:0010200	P	response to chitin
GO:0010243	P	response to organonitrogen compound
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0044212	F	transcription regulatory region DNA binding
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032502	P	developmental process
GO:0042221	P	response to chemical
GO:0043207	P	response to external biotic stimulus
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0051301	P	cell division
GO:0051704	P	multi-organism process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:0098542	P	defense response to other organism
GO:1901363	F	heterocyclic compound binding
GO:1901698	P	response to nitrogen compound
GO:1901700	P	response to oxygen-containing compound
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09286	EREBP; EREBP-like factor	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network