result

Gene information

Detail information of g412977

Location

Gene	Chr	Start	End	Strand
g412977	Scaffold_78278:HRSCAF_461364	222810	224225	+

Sequences

CDS

Protein

Gene

>g412977.t1
ATGGGTAGAGCGCCTTGCTGTGATAAGAGTAAAGTGAAGAGAGGCCCATGGTCACAAGAAGAAGATGCAATTCTCAAAACTTACATAGATCAAAATGGAACTGGTGGTAATTGGATTGCTTTGCCTCAAAAAATAGGTATCTTATCATTTTATTTTTCTGAAAATCAAAAAATTTGTAAACTTCGCTCATAAAACATTAAGAATATGTTCATATGTTTGAATTCATATATTATATTGATATATGGTTAACTAAGTTCGTTAGTTGAATTCTACCTAAGCATCTCATAACCTATTGATAAGTCAAACAAAATACTGACCTAACCCTAGATACTGATTATAAATTTTCTTAATTTTTATTTAATTTTGGTTAATTAAAACTCTACATGTTTATATTCAACTATGACTATATAGATAAGTAATCTGGGGTTTCAATATGTATTTATTTGTTTTCTTTAAAATTTTCAGTATATTAATTATATCCTAAATTATGGAACTATTGCAAAGAAAATAGGTTGAATATAACCATATTTGGCTGCCAAAACTGTTGCGAGTTCATAAGAAAGTATATATCCACTTTAAAATTTGGACGAATAACTAAACATACAGGTCTGAGAAGATGTGGGAAAAGTTGTAGACTTCGATGGCTCAACTATTTGAGACCTAACATCAAACATGGCGACTTCTCAGCGGAAGAAGATCGTCGTATCTGTGAACTTTTCGTCAGTATCGGAAGCAGGTAATTGTAGTTTCCTACATGTATCATTTATAACTCAACACTACTTTCATAATATTAGCTAAATATAACCTGAATCGCTTCATTAAATATGATTCAGATGGTCGGTAATAGCAGCTCAATTACCAGGAAGAACGGACAACGACATCAAGAACTACTGGAACACGAAGCTCAAGAAAAGATTGCTAGGACCTACTCAATCTCGAAACACACTTTCTGCGAATCAAGGAATACTGCATTCAGAAACCAATCTAATGAACTCAAATGCTATAGATAGAATGCAACTGCAGTTGCAATTCCAAGGTTTAGTGCATAGCCCCTTTTCTTTCTACAACAATCCTGCTTTGTGGCCTAACTCCCACCCACTTGGGAAGTTGAATAATGTTAACTGTAATGATGTTGTTATTAGTTCGAACAATGAACAACCAATGATCGAAAATAGTATTCAGGATGATGGAAGTTTGAACATGAAATATAATGAACTCATTGAGCTGAGTAATTATCAAGGAATGAATGAGATTAATGTTGGTAAGGATATGGATGCGAATATGAATTGGTGGGATTTTAATGGATTTGAGGTGAAATCATCATCAAGTTCGGGAGTGTTCCAGGAATCGAGTACCTCTGTTGATGCTAATGGCTTTGATCAGGAGTATGTGCTGGATTATGATATGTTAGCTTGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020267773.1	6.5e-73	transcription factor MYB36-like
Swissprot	Q9FKL2.1	1.6e-68	Myb-related protein 36
trEMBL	A0A5P1EUN3	4.7e-73	Transcription factor MYB36-like

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G57620.1	63.81	2e-70	262	AtMYB36;MYB36	myb domain protein 36

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g412977	AT5G57620.1	210	63	4	1	199	1	208	63.81	2e-70	262
g412977	AT5G65790.1	118	19	0	1	118	1	118	83.90	1e-58	223
g412977	AT3G49690.1	118	23	0	1	118	1	118	80.51	2e-57	219

Ortholog group

Species	Genes
Allium cepa	g412977.t1
Allium fistulosum	AfisC6G04614
Allium sativum	Asa8G02642.1
Arabidopsis thaliana	AT5G57620.1
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00249.28	Myb_DNA-binding	Domain	14	62	51.1	1e-13
PF00249.28	Myb_DNA-binding	Domain	69	111	45.0	8.1e-12

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0000988	F	transcription factor activity, protein binding
GO:0000989	F	transcription factor activity, transcription factor binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0001076	F	transcription factor activity, RNA polymerase II transcription factor binding
GO:0001101	P	response to acid chemical
GO:0001134	F	transcription factor activity, transcription factor recruiting
GO:0001135	F	transcription factor activity, RNA polymerase II transcription factor recruiting
GO:0001704	P	formation of primary germ layer
GO:0001706	P	endoderm formation
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005618	C	cell wall
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0007275	P	multicellular organism development
GO:0009653	P	anatomical structure morphogenesis
GO:0009790	P	embryo development
GO:0007369	P	gastrulation
GO:0009888	P	tissue development
GO:0007492	P	endoderm development
GO:0008150	P	biological_process
GO:0008285	P	negative regulation of cell proliferation
GO:0042493	P	response to drug
GO:0009505	C	plant-type cell wall
GO:0009531	C	secondary cell wall
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009751	P	response to salicylic acid
GO:0009889	P	regulation of biosynthetic process
GO:0009890	P	negative regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009892	P	negative regulation of metabolic process
GO:0009893	P	positive regulation of metabolic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010558	P	negative regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010605	P	negative regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0010629	P	negative regulation of gene expression
GO:0044212	F	transcription regulatory region DNA binding
GO:0048646	P	anatomical structure formation involved in morphogenesis
GO:0014070	P	response to organic cyclic compound
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0045892	P	negative regulation of transcription, DNA-templated
GO:0046677	P	response to antibiotic
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022603	P	regulation of anatomical structure morphogenesis
GO:0030154	P	cell differentiation
GO:0030312	C	external encapsulating structure
GO:0031323	P	regulation of cellular metabolic process
GO:0031324	P	negative regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031327	P	negative regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0035987	P	endodermal cell differentiation
GO:0042127	P	regulation of cell proliferation
GO:0042221	P	response to chemical
GO:0042592	P	homeostatic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044426	C	cell wall part
GO:0044462	C	external encapsulating structure part
GO:0044464	C	cell part
GO:0045595	P	regulation of cell differentiation
GO:0045597	P	positive regulation of cell differentiation
GO:0045934	P	negative regulation of nucleobase-containing compound metabolic process
GO:0050801	P	ion homeostasis
GO:0048226	C	Casparian strip
GO:0048518	P	positive regulation of biological process
GO:0048519	P	negative regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048523	P	negative regulation of cellular process
GO:0048598	P	embryonic morphogenesis
GO:0048856	P	anatomical structure development
GO:0048869	P	cellular developmental process
GO:0048878	P	chemical homeostasis
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051094	P	positive regulation of developmental process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051172	P	negative regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0051253	P	negative regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0065008	P	regulation of biological quality
GO:0071944	C	cell periphery
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1901700	P	response to oxygen-containing compound
GO:1902679	P	negative regulation of RNA biosynthetic process
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903507	P	negative regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000026	P	regulation of multicellular organismal development
GO:2000067	P	regulation of root morphogenesis
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000113	P	negative regulation of cellular macromolecule biosynthetic process
GO:2000280	P	regulation of root development
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110
GO:1905421

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09422	MYBP; transcription factor MYB, plant	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network