result

Gene information

Detail information of g430156

Location

Gene	Chr	Start	End	Strand
g430156	CHR6	207883986	207884990	+

Sequences

CDS

Protein

Gene

>g430156.t1
ATGGCGCAATTGCCACCAAAGGTACCGTCCCACGCCATGTGGCCTTCTTCCTCCCCCTTCCAAAAGCTGCCCTCCATGGCTTCGTTCTCCACCACCAACGCGGCCAATAACAGCATCAACAACAATTCGTGGGTGGACGAGTTTCTGGACTTCTCCGCATTACGCCGTGGGGCCCACCGCCGCTCAGTCAGCGACTCCGTCACCTTCCTCGAGGCGCCGCCACCTGCTGACGACGACGACGACCAATTCGATCGTATGAACGATGAAACCTTCATGTCCTTGCTCAACGTGGATGATCTAGTCAATGCTCCCAATTCCCCCAATTCCGACCCCGATAGTGGATTGCTGATTAATAGTGATAAGAATAAATGCGAAGAGAACTACGTAGAGGGCCAAAAATGCAAAGCTGAATCAAATGTCGCACACAAGCAAGAGGAAGTCGAGGATGTCAAACCTGAACCCTTGGATCCCAAAAGGGTTAAACGGTACTTAATTAATCTTAACTGCCCTAATTTTCTTCCTATAATTTTTATTAATCTCCTGCTATTGTAGGATCTTAGCTAACAGGCAGTCTGCACAGAGATCACGAGTCAGAAAATTGCAGTACATATCAGAGCTTGAACGAAGTGTAACTACGTTACAGGTATAAGATTTTAGTAAATGATCAAAATATTATTGTGAATTGTGCTTAAGTTATTGATATTTTGATGTTGATGACAGACAGAGGTATCGGCATTGTCGCCTAGAGTTGCATTCTTGGATCATCAGAGGTCAGTTTTGACCGTGGGCAACAGCCATCTGAAGCAGAGGATAGCTGCTCTTGCTCAAGACAGGATTTTTAAAGACGGTTGGTTCAGTTAAACAAATAATTCAATTGTGTATAATTATGAAAAAATTAACAAACAAAATAAAAATGCAGCTCATCAAGAAGCACTGAAGAAAGAACTTGAGAGATTAAGGAGTGTGTACAACCAGCAAAATCAAAATTCATCTACAAGTGACTGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_010925682.1	5.3e-61	basic leucine zipper 61
Swissprot	Q5JMK6.1	4.1e-50	Basic leucine zipper 6
trEMBL	A0A8K0HXX0	2.7e-62	Basic leucine zipper 61

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G42380.2	53.63	3e-64	241	ATBZIP34;BZIP34	Basic-leucine zipper (bZIP) transcription factor family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g430156	AT2G42380.2	289	94	8	1	254	1	284	53.63	3e-64	241
g430156	AT3G58120.1	303	96	11	1	254	1	300	51.16	4e-64	241
g430156	AT2G42380.1	289	92	9	1	254	1	273	50.52	2e-56	216

Ortholog group

Species	Genes
Allium cepa	g332930.t1; g430156.t1
Allium fistulosum	AfisC6G01690; AfisC6G03166
Allium sativum	Asa8G03750.1; Asa8G04833.1
Arabidopsis thaliana	AT2G42380.1; AT2G42380.2; AT3G58120.1
Oryza sativa	LOC_Os01g11350.1; LOC_Os01g55150.1; LOC_Os02g14910.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00170.18	bZIP_1	Family	158	206	39.8	3.2e-10

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000976	F	transcription regulatory region sequence-specific DNA binding
GO:0000977	F	RNA polymerase II regulatory region sequence-specific DNA binding
GO:0001012	F	RNA polymerase II regulatory region DNA binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003690	F	double-stranded DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0044212	F	transcription regulatory region DNA binding
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:1990837	F	sequence-specific double-stranded DNA binding
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K04374	ATF4, CREB2; cyclic AMP-dependent transcription factor ATF-4	EC:-	Protein processing in endoplasmic reticulum	ko04141
			MAPK signaling pathway	ko04010
			TNF signaling pathway	ko04668
			cGMP-PKG signaling pathway	ko04022
			PI3K-Akt signaling pathway	ko04151
			Mitophagy - animal	ko04137
			Apoptosis	ko04210
			Apoptosis - fly	ko04214
			Insulin secretion	ko04911
			Glucagon signaling pathway	ko04922
			GnRH signaling pathway	ko04912
			Estrogen signaling pathway	ko04915
			Relaxin signaling pathway	ko04926
			Growth hormone synthesis, secretion and action	ko04935
			Thyroid hormone synthesis	ko04918
			Parathyroid hormone synthesis, secretion and action	ko04928
			Aldosterone synthesis and secretion	ko04925
			Cortisol synthesis and secretion	ko04927
			Adrenergic signaling in cardiomyocytes	ko04261
			Cholinergic synapse	ko04725
			Dopaminergic synapse	ko04728
			Long-term potentiation	ko04720
			Neurotrophin signaling pathway	ko04722
			Longevity regulating pathway	ko04211
			Longevity regulating pathway - worm	ko04212

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network