result

Gene information

Detail information of g430507

Location

Gene	Chr	Start	End	Strand
g430507	Scaffold_80305:HRSCAF_463391	253181	254436	+

Sequences

CDS

Protein

Gene

>g430507.t1
ATGATGGCTCGCGCTGGAAATGCTAAAAATACAGAGGAATTAACACAAGTAAAGAGGTTTTCGTCAACTACATGCGAGAGAGAGCTTAACATCTCAATCGATAAAGACAAAACTGATGTTACAGTATTATGTAGTACTTTTTCAAACGGGTCAGAGATTTTTAATGGAGATACATCATCATATCATAACACGAAGGTTGTTAAAGGAAAAGGAGTAAGGCATGGTTCAAATCTTAATTCTTCTGCTTCTTCCAAAGATTTGAATCTTGTCAAAGGGAAATGGAGTAAGGAAGAGGATAGGTAACTTTTTTAATTTCATTTAAGATATTCTTATACATATCAATTTTTTCGGTGTTTGATTATGTTTTATTTTTGTGATGTAGCATGTTAATAAGATTGGTAAGGCAACATGGAGTTCGAAAGTGGTCTGAAATTGCGAAGGAATTAGTTGGTAGAATGGGAAAGCAATGCAGAGAAAGGTGGCACAATCATTTGCGACCGGATATCAAGGTAAAGATTATTAAACCACATTCATCATTGATGTAATATATTATTATGCATTGTATTAGATAATGCATAATTTGATTAACCTTAAATAGCTTTGTTAAGTTTTTGTTTCATTAAAATCTATGTAGAAAAATCAGAAGATATTGTATCAAATGAATTATCCGGTTTTTGGATTTTGTTCGTTTATATATGATCATATGATACAACATATACTAAGTTAAGATGCATTGGATTTAATACTTCATACAAGGCCAACAAAAAAATTAAAAATAAAATAAAAACTCATAAGATCGATTGTATGTTACGTGAATGGAATATTTGTAAATTAGGAATTTATTATAAATGAATTATTCTAGTCAAATTTCCATGTAGGTTACATATACAAGTTAACTATAATTTCCTAATTTAAAATTAGAATTAAAAAGTCAAGGACATTAAATAATCTCATGACTTTATTTTTATATACACGAATTGCTAGCCATTATGCATCATTAATTGTATATTGATGTAATTTCTAGTTCTTCATAAGTACCGGTAGTATTCATCAATCTCTCAACGTAGTCTACTTTCTATCTATAGAAGGAATCATGGAGTGAAGAAGAAGAGAGGCTTCTAGTTGAAGCTCATGAGAAGCTTGGAAATAAATGGGTAGAGATAGCGAAAAGAATCCCTGGGCGAAGCGAGAACTCAATCAAGAACCACTGGAATGCTGCTAAAAGAAAGCAATGCATGAACGGAAAAAGCAAATGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_018682912.1	2.0e-44	PREDICTED: transcription factor MYB44
Swissprot	Q9FIM4.1	2.4e-42	Myb-related protein 119
trEMBL	A0A7I8IC12	8.5e-45	Transcription factor MYB98-like

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G58850.1	66.93	3e-45	177	ATMYB119;MYB119	myb domain protein 119

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g430507	AT5G58850.1	127	40	1	65	191	81	205	66.93	3e-45	177
g430507	AT4G18770.1	134	53	0	58	191	184	317	60.45	1e-44	176
g430507	AT5G11050.1	104	28	0	88	191	102	205	73.08	4e-43	171

Ortholog group

Species	Genes
Allium cepa	g430507.t1; g477969.t1
Allium fistulosum	AfisC2G05635; AfisC2G05636; AfisC2G05637
Allium sativum
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF13921.3	Myb_DNA-bind_6	Domain	94	154	69.9	1.4e-19

Gene Ontology

Accession	Ontology	Name
GO:0000003	P	reproduction
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0000988	F	transcription factor activity, protein binding
GO:0000989	F	transcription factor activity, transcription factor binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0001076	F	transcription factor activity, RNA polymerase II transcription factor binding
GO:0001134	F	transcription factor activity, transcription factor recruiting
GO:0001135	F	transcription factor activity, RNA polymerase II transcription factor recruiting
GO:0003006	P	developmental process involved in reproduction
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0006935	P	chemotaxis
GO:0007275	P	multicellular organism development
GO:0008150	P	biological_process
GO:0009553	P	embryo sac development
GO:0009605	P	response to external stimulus
GO:0009856	P	pollination
GO:0009889	P	regulation of biosynthetic process
GO:0010183	P	pollen tube guidance
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0044212	F	transcription regulatory region DNA binding
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022414	P	reproductive process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0040011	P	locomotion
GO:0042221	P	response to chemical
GO:0042330	P	taxis
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0044706	P	multi-multicellular organism process
GO:0045595	P	regulation of cell differentiation
GO:0045691	P	regulation of embryo sac central cell differentiation
GO:0045697	P	regulation of synergid differentiation
GO:0048229	P	gametophyte development
GO:0048856	P	anatomical structure development
GO:0048868	P	pollen tube development
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0050918	P	positive chemotaxis
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0051704	P	multi-organism process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000026	P	regulation of multicellular organismal development
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09422	MYBP; transcription factor MYB, plant	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network