result

Gene information

Detail information of g46162

Location

Gene	Chr	Start	End	Strand
g46162	CHR3	234563926	234580699	-

Sequences

CDS

Protein

Gene

>g46162.t1
ATGGATATACAAATTATGAGGTTATATTTGATTAAATTTTAATAAAATTCACAGACACCATCATAATGGAAGATGGGAAGCACGAATTGGCCGTGTCTTCGGCAACAAATATTTGTATCTCGGAACTTACGGTAAATTTTTATCTTATTTTTTGTTAAAAAAGAAAAAGAAATAGAAAACTCAGTATTTAAATTTATTTTATTTAAGAAGAAAACTTGTACGTACTGTTCTCTTTTGATACGTACGCTTTTCGAATTGCACATAATTCATACATAAACAACGATAAAACTCTGGCAGTACCATTGTATATCAAATAATCAGTCACCTAGACATAACTAACACTTTTGACTAACGTGTACTTAGGTAGATTTGTTGATGCATTTGTCAACTAAGGTAAGGAAGCTCAATAACTTCACATTCTATTGATGGTTGAGTTATAAGTGCATATCCCCATACAAAGTCCATAATTGTTAGTTGGTAGTAGGAGACATTATTAGTTTTAAATCCCACCTATAATCCAACAGTTTTTTGTCACTCAAATTTTATGGTAACCTACTATTATCGGCTTTAAAATTTATTTAATTTGCACCCCTTTTTTGGAGGGGCAGCCATTAATATTCATTTTCTCTCATCATATATGCCTTCCTCCGTACCCGTTAATGCTATTCGTGCATGACATTATTGCTTGACCTTGTTGCTTGCAATAATAATATAACATATTATGACTTATTATTAAAGCAACTCAAGAAGAAGCGGCAACTGCATATGACATGGCAGCAATAGAGTATCGAGGACTGAACGCTGTAACCAACTTCGATCTAAGTCGATACATCAAATGGCTTCGACCAAACTCCGATAACAGCCAAAGCAACACTCAAACTAATAGCATAATCGTTGGTAACTCTTCACTGACGAACATCGTGCATGATCATGACTTAAACAGCAACAATAATAACAACAGTCAGACTCAACAGAAACAAGAGAACACTGCAGATGTTTCATCTTCATCGACCGTTACACACTCTGGAAGTGGAAGTGGAAGTGCTACATCTGCTCTAAGTCTTCTGTTTCAGTCTCCCAAATTTAAAGAGATGCTGGAGCAGAGTTCTGCAATTAGTCTACCGTGTGACTCAATGGCTGAAGCTGAAAATAAGGTGTCGAAGTGCAGCTTTCCTGATGATATTCAGACTTACTTTGGGTGCCATGATGGGATCGCTTATGCAGAAGGAGATGATGCTATTTTTGGGGACTTCACTACGTTTGCATCTCCGGTTATTCAGTTCGAATTTGATGAATGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_010914036.1	3.2e-51	AP2-like ethylene-responsive transcription factor At1g79700
Swissprot	Q94AN4.1	6.7e-30	AP2-like ethylene-responsive transcription factor At1g16060
trEMBL	A0A6I9QVP6	2.3e-51	AP2-like ethylene-responsive transcription factor At1g79700

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G16060.1	43.27	9e-32	133	ADAP;WRI3	ARIA-interacting double AP2 domain protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g46162	AT1G16060.2	208	81	5	5	210	94	266	43.27	8e-32	133
g46162	AT1G16060.1	208	81	5	5	210	164	336	43.27	9e-32	133
g46162	AT1G79700.2	213	65	4	5	217	158	310	41.31	1e-31	133

Ortholog group

Species	Genes
Allium cepa	g46162.t1
Allium fistulosum	AfisC8G01581
Allium sativum
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00847.17	AP2	Domain	7	51	35.7	7e-09

Gene Ontology

Accession	Ontology	Name
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0001101	P	response to acid chemical
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0006950	P	response to stress
GO:0006970	P	response to osmotic stress
GO:0008150	P	biological_process
GO:0009414	P	response to water deprivation
GO:0009415	P	response to water
GO:0009628	P	response to abiotic stimulus
GO:0009651	P	response to salt stress
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009737	P	response to abscisic acid
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0010029	P	regulation of seed germination
GO:0010033	P	response to organic substance
GO:0010035	P	response to inorganic substance
GO:0010187	P	negative regulation of seed germination
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010565	P	regulation of cellular ketone metabolic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0046889	P	positive regulation of lipid biosynthetic process
GO:0019216	P	regulation of lipid metabolic process
GO:0019217	P	regulation of fatty acid metabolic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0033993	P	response to lipid
GO:0040008	P	regulation of growth
GO:0042221	P	response to chemical
GO:0042304	P	regulation of fatty acid biosynthetic process
GO:0045723	P	positive regulation of fatty acid biosynthetic process
GO:0045834	P	positive regulation of lipid metabolic process
GO:0045923	P	positive regulation of fatty acid metabolic process
GO:0046890	P	regulation of lipid biosynthetic process
GO:0048518	P	positive regulation of biological process
GO:0048519	P	negative regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048580	P	regulation of post-embryonic development
GO:0048581	P	negative regulation of post-embryonic development
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051093	P	negative regulation of developmental process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051241	P	negative regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097305	P	response to alcohol
GO:1900140	P	regulation of seedling development
GO:1901700	P	response to oxygen-containing compound
GO:1901957	P	regulation of cutin biosynthetic process
GO:1901959	P	positive regulation of cutin biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000026	P	regulation of multicellular organismal development
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0062012
GO:0062013
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09285	OVM, ANT; AP2-like factor, ANT lineage	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network