result

Gene information

Detail information of g473688

Location

Gene	Chr	Start	End	Strand
g473688	Scaffold_84830:HRSCAF_467916	1810335	1811706	+

Sequences

CDS

Protein

Gene

>g473688.t1
ATGGAGTTTCCTCAATATCCATTAGCATCCCACTCTCAACAAATTAATCATACCCAAGATGAAGAAAAGCACAATACCTCATCATCGAACACTACCACAAACTCATCTCACCCGGAGCGCATGTTTGAAAAGGTCGTAACTCCAAGTGATGTAGGCAAGCTCAACCGACTCGTTATCCCAAAGCAACATGCCGAGCACTACTTCCCACTAGACCCTTCTTCCAACGAAAAGGGAGGTCTACTTCTAAACTTCGAAGAAATTCATTCAGGTAAGCCATGGAGGTTTAGGTACTCGTATTGGAACTCGAGCCAAAGTTATGTCATGACTAAAGGGTGGAGTAGGTTTGTCAAGGATAAAAGGCTCAATGCGGGGGATACGGTGTCTTTCTTTAGGGGTTATGAAGGGAGGTTGTTTATCGACTGGAGAAGAAGAGTGGTTGTACCGGAGATGCCAATGATGCGTTCCAATGTACCTAGTTGGGGTTGGGGTACTTCTTTGTATCTTAGGACTATACCACAGGTAATGGTTGAATATTAGGGTTTGATTGTTTTGGATTGGTAGCTATTTAAAAAGGAAGCAAATAGAAGAACCAGTTTGTGAATAGTTTTCTTTTTTTTGGTTGCTTCTAAAATTTTAGACTATTTGTTTTGCATTGTTGTTATATTTGTTCATCCTAACATTATTAACTGCAAATAGATGTGCATTCTACTTAGGTTGGATTCGTTTCAACATTGGTTTAAAACTGAGAAGTATGTCAAATATATTTTCGTTCGTCATGTGGTCACTGAAGTAATCAATTAATTTCTAGACTCATTACCAGTGATTTTTGCATTAGCACTGATTGACAAAATATAAATGCAGGAGTTCACCCGATTTAAAGCTCGAGATCAATAAGCTAGCAGTCTAATCTAAACTAATCATTGCATCTTTAGCATATTTGGCAACTTAACGAGTTTCTAAAGTGCACTGAGTGATATAGACTAATAGATGTTTGATTTAGTTGCTATGATCTATGAGTTAATCCTTTCAATTTTTCAACCAAAGCTGATGACGCTAGTATTCATAAGTGTTGCTCTAAAATTAATTATTTCTTATTGCCTAATTAACAATATTGATGACTACCTAGGCTAGAGTTGAGCATGGTATATTACAGTCAGTGCCTGTGGCGGTGCATAGATCAAATATGAATGAGCCAACTAGAAGACAAGTTCGACTATTTGGCGTAAACATTGATGAACGTAATTCAGAACAGGAGAACCCTCCATCTCCACTCCAATGGACACTTTCTTCCATATCTCCTTCAACGAGGAATACCGAGCTTCAATTGATGCCAAGGAGGACTAGTAGTGATGATGATGAAAATAAATACTAA

Functional annotation

Database	accession number	e-value	annotation
nr	EAY88313.1	8.0e-46	hypothetical protein OsI_09772
Swissprot	Q8LMR9.1	2.8e-48	B3 domain-containing protein Os03g0120900
trEMBL	A0A0D3FD45	5.8e-46	TF-B3 domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G46870.1	48.90	3e-47	185	NGA1	AP2/B3-like transcriptional factor family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g473688	AT2G46870.1	227	66	8	39	217	32	256	48.90	3e-47	185
g473688	AT3G61970.1	213	75	7	32	209	13	223	47.42	2e-43	172
g473688	AT1G01030.1	122	29	4	39	155	53	169	68.03	1e-40	163

Ortholog group

Species	Genes
Allium cepa	g473688.t1
Allium fistulosum	AfisC3G06421
Allium sativum	Asa2G05404.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF02362.18	B3	Family	42	144	92.5	1.1e-26

Gene Ontology

Accession	Ontology	Name
GO:0000003	P	reproduction
GO:0003006	P	developmental process involved in reproduction
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007275	P	multicellular organism development
GO:0008150	P	biological_process
GO:0009791	P	post-embryonic development
GO:0009889	P	regulation of biosynthetic process
GO:0009908	P	flower development
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022414	P	reproductive process
GO:0022603	P	regulation of anatomical structure morphogenesis
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0048366	P	leaf development
GO:0048367	P	shoot system development
GO:0048608	P	reproductive structure development
GO:0048731	P	system development
GO:0048827	P	phyllome development
GO:0048831	P	regulation of shoot system development
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0061458	P	reproductive system development
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0090567	P	reproductive shoot system development
GO:0099402	P	plant organ development
GO:1900618	P	regulation of shoot system morphogenesis
GO:1901371	P	regulation of leaf morphogenesis
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000024	P	regulation of leaf development
GO:2000026	P	regulation of multicellular organismal development
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110
GO:1905421

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network