result

Gene information

Detail information of g491996

Location

Gene	Chr	Start	End	Strand
g491996	Scaffold_87198:HRSCAF_470284	668581	670021	-

Sequences

CDS

Protein

Gene

>g491996.t1
ATGCACTCACCGCCAACTACACATGCTGATCCTGCCGCTGCTTGCACTTGTCGCACGCTTGCCTCAATTTCCATCCCCTGCATTCCACCATCGCACGCTTGCCTCATTTTCACTCGTCAAAAACAAGCTACTACCACCAACCTGCACCTATAACCATCGCCTATTTGCACTTGCTATGTCGAACTTTTTTTGACAGTCTAAAATTTTGGCTATCGTCCTTCGTTAGAAAATGCATCAAGCTTTTTTTTTCTTTTTTCTTCTTCTATTTTATCAATTCATAAATTGTTATTGGATTTACCGAGTTTTACATGTGTAACCCACAACAATAACGAAAATTTCCATACTAAGTACAAAATAACAACTACTTTTAAATTAAAGCAATTGCATGTGCTCGTTAATGGCTTACAATGCTATTTTGTGATCTTTGTCTATAATTGTAAAGAATAAAATATCAAAGCGGATGGAGAAGTTTTTATCGAGCAACTAACTCCAAACATCGAAGCTCAAACTAAAGTCTAGTAGTATTGGATCGTTGATTGTTGTAAAAAAATTTTTGCATCAACAGGCTTAAATCATAAAACTATTATGCGTTTATTTTGTTTTTCGAAAAAACTGAAAATGGCGAGTTTTAAAATACTGTTTTCAGTTTCATATGTCATACGTTTTTTCATCATTAATGATTTTGATATTTAATCTTATGAACTACTAACCCCACAGGTTTGATCATTCCAGAAAAAAGTCTTAAAATAGCAAACCAAACGAGCGACGAGCTACTGCGAGGCCCACGGCCTAACAAAATATTCAAATCGAACAACCACGAAGTTTCTGGACGTAATTCCAACCAAACCAAACTTGGCGCCCAAGACACTCGCCCACATCCAGACCTCATCCGAACATTCCAGACTCGTTCTCCATATAAATAGCCTCCTTCGTCCCCTTTTCTTCATCAAATCAAATTCAATAAAAGCAAATTTGAGTTTCATTAATCCAAATCCCACGAATTAAAATGCCATCCCGATCAACCGGAGCAATCGTCCAGCAATGGGATCCGGTCGTCATCTCCCGCCGTAAACCAAAAACCGCTGATCTGAAAGACCCGAAAGTGGTTAACAGTGCGATCCGTGCCGGTGCGCAAGTCGAGACGATCAAAAAGTTCGACGCTGGTCAGAACAAGAAGAAGGCTGAGCCGGTGGTTAATGCGAGAAAGCTCGACGAACAGACGGAACCTGGGACGCTGAACCGTGTGCCAGGGGAGGTGAGGGCGGAGATCCAGAAGGCGAGGTTGGCGAAGAAGATGAGTCAGGCGGAGCTGGCGAAGCAGATCAACGAGCGAGTGCAGGTGGTGCAGGAATATGAGAACGGTAAGGCTGTTTTAAACCAGGGTGTTTTGGCTAAGATGGAGAAGGTTCTTGGGGTTAAACTAAGGGGAAAGCATAAGTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_004512966.1	2.9e-48	multiprotein-bridging factor 1c
Swissprot	Q9LV58.1	2.0e-46	Multiprotein-bridging factor 1c
trEMBL	A0A1S2Z0S9	2.1e-48	multiprotein-bridging factor 1c

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G24500.1	68.28	2e-50	196	ATMBF1C;MBF1C	multiprotein bridging factor 1C

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g491996	AT3G24500.1	145	43	1	112	253	1	145	68.28	2e-50	196
g491996	AT3G58680.1	137	67	1	118	253	5	141	50.36	6e-33	137
g491996	AT2G42680.1	137	69	1	118	253	5	141	48.91	5e-31	131

Ortholog group

Species	Genes
Allium cepa	g491996.t1
Allium fistulosum	AfisC1G01470
Allium sativum	Asa2G06716.1; Asa4G01103.1; Asa6G04159.1; Asa7G01409.1
Arabidopsis thaliana	AT3G24500.1; AT3G24500.2
Oryza sativa	LOC_Os06g39240.1; LOC_Os06g39240.2

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF08523.7	MBF1	Family	122	191	67.5	9.2e-19
PF01381.19	HTH_3	Domain	199	250	45.8	4.3e-12

Gene Ontology

Accession	Ontology	Name
GO:0000160	P	phosphorelay signal transduction system
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001101	P	response to acid chemical
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0003712	F	transcription cofactor activity
GO:0003713	F	transcription coactivator activity
GO:0007165	P	signal transduction
GO:0035556	P	intracellular signal transduction
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005737	C	cytoplasm
GO:0005730	C	nucleolus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006950	P	response to stress
GO:0007154	P	cell communication
GO:0008150	P	biological_process
GO:0009266	P	response to temperature stimulus
GO:0009408	P	response to heat
GO:0009414	P	response to water deprivation
GO:0009415	P	response to water
GO:0009628	P	response to abiotic stimulus
GO:0009719	P	response to endogenous stimulus
GO:0009723	P	response to ethylene
GO:0009725	P	response to hormone
GO:0009737	P	response to abscisic acid
GO:0009755	P	hormone-mediated signaling pathway
GO:0009873	P	ethylene-activated signaling pathway
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010035	P	response to inorganic substance
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0031974	C	membrane-enclosed lumen
GO:0031981	C	nuclear lumen
GO:0032870	P	cellular response to hormone stimulus
GO:0033993	P	response to lipid
GO:0042221	P	response to chemical
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043228	C	non-membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043232	C	intracellular non-membrane-bounded organelle
GO:0043233	C	organelle lumen
GO:0044422	C	organelle part
GO:0044424	C	intracellular part
GO:0044428	C	nuclear part
GO:0044446	C	intracellular organelle part
GO:0044464	C	cell part
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0051716	P	cellular response to stimulus
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0070013	C	intracellular organelle lumen
GO:0071310	P	cellular response to organic substance
GO:0071369	P	cellular response to ethylene stimulus
GO:0071495	P	cellular response to endogenous stimulus
GO:0080090	P	regulation of primary metabolic process
GO:0097305	P	response to alcohol
GO:1901700	P	response to oxygen-containing compound
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K03627	MBF1; putative transcription factor	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network