result

Gene information

Detail information of g494334

Location

Gene	Chr	Start	End	Strand
g494334	Scaffold_87458:HRSCAF_470544	110414	111524	+

Sequences

CDS

Protein

Gene

>g494334.t1
ATGGACGAGTCTATAAACTTGCCACCAGGTTTCAGATTTCATCCTACAGATGAAGAAATCATAACTCATTACTTGTCTCCTAAAATTCTCAATCAAAACTTCACTACGATCCCTATTGGAGAGATCGATTTGAACAAGTGCGAGCCTTGGGATCTTCCTAGTAAGTATATATTTTTCTTCCAAACTTTCTGTTATGTATTAATGTTTTATGATTTTATATTTATCAAATAAATAATTAAATATGTAGGTAAAGCAAGGATGGGTGAAAAAGAATGGTACTTTTTTTGCCAAAGAGACAGAAAGTACCCAACTGGAATGAGAACTAATCGAGCTACGGAAGCAGGATACTGGAAGGCTACTGGCAAAGATAAAGAAATATTCAAAGGCAAAAACAATACCAAGGTTCTTATCGGCATGAAGAAAACGCTTGTATTTTACACAGGTAGAGCCCCTAAAGGAGTTAAAAGCAACTGGGTCATGCACGAGTTCAGACTTGAAGGCACATCTGCTGAGGCCAACTTTCCTAAACCCGCAAAGGTACAATCTTTACACCAAAGATGTATTCTTCTGTGTGTTTTATGCTGTTTTTTACATCAAAGATTTAATTTTTTGCATGTTTTATGCAATTTTTTAATCTTTTTATTTTTTGCTTGAATTGTAGGATGAATGGGTGGTTAGTAGGGTGTTCCATAAGAGCAACGGAGCAAAGAAAAGTCCGATAAGCGACTACTTTGGTTCTGGGAGTTTACCAACTTTAATGGATCCGACTCCGTTCGTAAACAACGAGGATCTAATCAATAATTTCGACATGATGAATTCTTCATGCTTTTACAATGTTCCAGGATTAGATGATGCACAGAATTTCAATCAAAATTATCAACAAATGGGGCAAGTGAATGGTTCAACTTCAAACTACAACTACTTGCATCATAATCCGATGATGAAAATGGAGCAATTTCCAAAAAGATCAATGGTTAGTGATGACACCGGGCTTAGCACAGATAGAAACACAGAAATTTCTTCTGTCGTTTCAGGCCATGAGATTAAGAATGAGTTTGAAATGCCTACTGTTGGTTCAGTGTTGGATTTGGAAAACATGTGGAAGTTCTAA

Functional annotation

Database	accession number	e-value	annotation
nr	AUR26472.1	1.2e-104	NAC2716, partial
Swissprot	Q9FK44.1	1.8e-78	NAC domain-containing protein 87
trEMBL	A0A3S6RHW8	8.4e-105	NAC2716 (Fragment)

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G18270.2	54.58	6e-81	297	ANAC087	Arabidopsis NAC domain containing protein 87

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g494334	AT5G18270.2	306	107	9	2	284	16	312	54.58	6e-81	297
g494334	AT5G18270.1	306	109	9	2	284	16	312	53.92	3e-80	295
g494334	AT5G61430.1	333	129	9	2	299	11	336	48.65	1e-76	283

Ortholog group

Species	Genes
Allium cepa	g494334.t1
Allium fistulosum	AfisC6G03831
Allium sativum	Asa8G03231.1
Arabidopsis thaliana	AT3G04060.1; AT5G18270.2
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF02365.12	NAM	Family	8	136	102.8	1.2e-29

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005737	C	cytoplasm
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009894	P	regulation of catabolic process
GO:0009896	P	positive regulation of catabolic process
GO:0010271	P	regulation of chlorophyll catabolic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031329	P	regulation of cellular catabolic process
GO:0031331	P	positive regulation of cellular catabolic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048831	P	regulation of shoot system development
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0051094	P	positive regulation of developmental process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051193	P	regulation of cofactor metabolic process
GO:0051194	P	positive regulation of cofactor metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051240	P	positive regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0090056	P	regulation of chlorophyll metabolic process
GO:1900055	P	regulation of leaf senescence
GO:1900057	P	positive regulation of leaf senescence
GO:1901401	P	regulation of tetrapyrrole metabolic process
GO:1901403	P	positive regulation of tetrapyrrole metabolic process
GO:1901404	P	regulation of tetrapyrrole catabolic process
GO:1901406	P	positive regulation of tetrapyrrole catabolic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903648	P	positive regulation of chlorophyll catabolic process
GO:2000024	P	regulation of leaf development
GO:2000026	P	regulation of multicellular organismal development
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110
GO:1905623

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network