result

Gene information

Detail information of g496090

Location

Gene	Chr	Start	End	Strand
g496090	Scaffold_87681:HRSCAF_470767	1094000	1095084	-

Sequences

CDS

Protein

Gene

>g496090.t1
ATGGATAATTCTACATGGTTCAATTCAATAAATCTCGATCTCAGTATCGGTCATACTTCAAGAAACGAAAAGGTTAGTTGGTTGGTTAACTGAATCAATTCAAATGCCACTACTTTTTTTTTTCTTTCCAAACACCTTCATGTTTTGGCAACTTACAACAATGAAATCTCTGAATAAATTTCAGATAAGTGCACTTGAGGAAGAAATAAAGCAACAGAGGGAAGAAAACAAAACGCTGAACGAGAAGATATCAGCAATGCAAGCGAATTATAACATGATGCAAAGCCAATATGTCAAAATTATGAGTAGCACTACATCTTCGAATAGTGCAATGAATTCTTCGTCTACCCGAAAAAGAAATAGTACATCAAGTGATGAAGAAAGACTACTGAATGACGAAGGCGGTCAGGCCAGAATATCAAAACTAAGCGTTGAAACAGATCCATTGGATACAAGTCTGGTCAGTTTATGTTTCGGTTCATGCATTAAATTTCTGCGCCCATAACTTGTAATTTGAAGTAGGTTGACTTAATGTTGATTTTGTAAATAGGTGGTTAAAGATGGGTATCAGTGGAGGAAGTATGGTCAGAAAGTGACTAGAGATAATCCTTATCCAAGAGCCTACTATAAATGCTCTTTTGCCCCACTGTGTCCTGTTAAAAAGAAGGTATTGCCTTTTTTTTCTCTTCCTTATACATATACCATAATGCATTATCAGTAGTATTTGTTGTTACTAAAATGTAAATAAAGACTAATAAATGGAATTTATATAGGTACAAAGGAGCGCAGAAGACCATTCAATTTTAGTGGCGACATACGAAGGTGAGCACATACACGTAAGAGCTGCGTCGGTAGGCACATCCGAGTCGAATATTTCATGCTCTATGAGTGCAAATGTGACACGAGACATTACTCGACCCAAAGCCATAAGAACGGATGAAAGAACAAGTGGTTTGAATGCTGAAAGTGAGGAGTTTAAAAGGCAGTTAGCGGAGCAGATGGCGTTGTCATTGTCCAATGATCCGGGGTTTAAGGAGGCTTTAGCCAGTGCTGTTTCTGAAAAGTTTATTAAATTTGCTCCTTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020265728.1	8.4e-43	LOW QUALITY PROTEIN: WRKY transcription factor WRKY71-like
Swissprot	Q6IEK5.1	3.9e-37	WRKY transcription factor WRKY76
trEMBL	A0A5P1EWL5	6.0e-43	WRKY domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G80840.1	36.52	3e-42	168	ATWRKY40;WRKY40	WRKY DNA-binding protein 40

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g496090	AT1G80840.1	282	139	5	12	253	13	294	36.52	3e-42	168
g496090	AT4G31800.2	275	122	6	21	255	41	305	37.45	2e-38	155
g496090	AT4G31800.1	275	122	6	21	255	42	306	37.45	2e-38	155

Ortholog group

Species	Genes
Allium cepa	g496090.t1
Allium fistulosum	AfisC5G05698
Allium sativum	Asa5G01037.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03106.12	WRKY	Domain	119	176	82.7	1.6e-23

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001067	F	regulatory region nucleic acid binding
GO:0001101	P	response to acid chemical
GO:0002237	P	response to molecule of bacterial origin
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006952	P	defense response
GO:0042742	P	defense response to bacterium
GO:0050832	P	defense response to fungus
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006950	P	response to stress
GO:0008150	P	biological_process
GO:0042493	P	response to drug
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0009611	P	response to wounding
GO:0051707	P	response to other organism
GO:0009617	P	response to bacterium
GO:0009620	P	response to fungus
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009751	P	response to salicylic acid
GO:0009889	P	regulation of biosynthetic process
GO:0009890	P	negative regulation of biosynthetic process
GO:0009892	P	negative regulation of metabolic process
GO:0010033	P	response to organic substance
GO:0010200	P	response to chitin
GO:0010243	P	response to organonitrogen compound
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010558	P	negative regulation of macromolecule biosynthetic process
GO:0010605	P	negative regulation of macromolecule metabolic process
GO:0010629	P	negative regulation of gene expression
GO:0044212	F	transcription regulatory region DNA binding
GO:0014070	P	response to organic cyclic compound
GO:0045892	P	negative regulation of transcription, DNA-templated
GO:0046677	P	response to antibiotic
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031324	P	negative regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031327	P	negative regulation of cellular biosynthetic process
GO:0031347	P	regulation of defense response
GO:0042221	P	response to chemical
GO:0043207	P	response to external biotic stimulus
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0045934	P	negative regulation of nucleobase-containing compound metabolic process
GO:0048519	P	negative regulation of biological process
GO:0048523	P	negative regulation of cellular process
GO:0048583	P	regulation of response to stimulus
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051172	P	negative regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051253	P	negative regulation of RNA metabolic process
GO:0051704	P	multi-organism process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0080134	P	regulation of response to stress
GO:0097159	F	organic cyclic compound binding
GO:0098542	P	defense response to other organism
GO:1901363	F	heterocyclic compound binding
GO:1901698	P	response to nitrogen compound
GO:1901700	P	response to oxygen-containing compound
GO:1902679	P	negative regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903507	P	negative regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000113	P	negative regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network