result

Gene information

Detail information of g52383

Location

Gene	Chr	Start	End	Strand
g52383	Scaffold_29541:HRSCAF_268423	39541	40581	-

Sequences

CDS

Protein

Gene

>g52383.t1
ATGCCACAAACACCTTCAACAAGATGGTGTCCAACACCAGAACAACTAATGTTTCTAGAAGAGATGTACAGAAGCGGAATCAGAACCCCAAACGCCTCACAAATTCAACATATCACCGCACACTTGTCGCTTTATGGAAAAATTGAGGGCAAAAATGTGTTTTACTGGTTTCAGAACCATAAAGCAAGGGACAGGCAAAAGCTGAGGCGTAAAATTAGCCGGCATCATCAGTTGCTTATTCATGGGCATGCCAACGCGGGTAGTGCTACTTCCCCAACTGCGCAGTTTCATAGTCTGGAAGATCAAACTGCAGTTTGTCTTTCTCCTACTTCTCCTGGTGCAGCCACGCCACTTCACTTCCTCGCTCATCAGGTCTGTTTTAATGTTTTAATGGTTTGTACGTTTAATAAACTACTGGAATTCTGCATATTTTCTTACATGCTCTAATTGAATAATTTAGGAATGTAGATTGGGCTACATTTTTAATGCATATTTAATTTGTTCATGATTTTTCATGAACATGCTATATCTAGGGTTTTACAGACTTCAGTGCTATATGCAAAACTTGTTCATATGTCAAGTCAAGGCTGCATTACTTCTCATAAACTTTAGTTGTCACATGCACATTCTTCAAGCAATTTGTTCCAGTTATTTACCAACATGACATTCGTGACTAATCACTGTGTATCTTCTCCAAAATCATGACTATCTATTTATCTATATATTTTGACTTTGTTCAAAAATTGGTTATATATTATGAATATTTTGATACAATGGTTGTAGGGAGGGGCTTATGATCAAGGGCAAGTTCAAGGCTTGAATTTGCTTTCCAAACTGGACACAAGTTATGATGGAATAATTCACCAAACAAACATAAACACAAACACAAACACAAGCAGTGGTTATAACTGGATGACGATGATGATGGATTGCAACAAAGAACCACCAAAAACACTTGATTTATTTCCTACAAAAAGCAGTGGACTCAAGGATGAATGTGGCACTTCTATTTCCTCCTCTTGCTCTACCTCAACCAACTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020274850.1	1.3e-54	WUSCHEL-related homeobox 3A
Swissprot	Q70UV1.1	6.6e-35	Narrow sheath protein 1
trEMBL	A0A8J5KWU1	1.7e-48	Homeobox domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G28610.1	39.09	7e-35	143	PRS;PRS1;WOX3	Homeodomain-like superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g52383	AT2G28610.1	243	87	6	6	195	6	240	39.09	7e-35	143
g52383	AT3G18010.1	79	29	0	2	80	70	148	63.29	3e-25	111
g52383	AT1G46480.1	64	19	0	7	70	89	152	70.31	1e-22	103

Ortholog group

Species	Genes
Allium cepa	g202184.t1; g460302.t1; g497240.t1; g504364.t1; g52383.t1
Allium fistulosum	AfisC1G01154; AfisC1G06506; AfisC1G06507; AfisC1G06511; AfisC1G06513; AfisC1G06520; AfisC2G02883; AfisC3G01730; AfisC5G04448
Allium sativum	Asa0G05545.1; Asa2G04201.1; Asa5G01500.1; Asa5G02437.1; Asa5G02438.1; Asa5G02897.1; Asa7G02965.1; Asa7G03012.1; Asa7G03013.1
Arabidopsis thaliana	AT1G46480.1; AT2G17950.1; AT2G28610.1; AT5G59340.1
Oryza sativa	LOC_Os04g55590.1; LOC_Os04g56780.1; LOC_Os11g01130.1; LOC_Os11g01130.2; LOC_Os12g01120.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00046.26	Homeobox	Domain	6	66	63.0	1.5e-17

Gene Ontology

Accession	Ontology	Name
GO:0000003	P	reproduction
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003002	P	regionalization
GO:0003006	P	developmental process involved in reproduction
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007275	P	multicellular organism development
GO:0007389	P	pattern specification process
GO:0008150	P	biological_process
GO:0008283	P	cell proliferation
GO:0009791	P	post-embryonic development
GO:0009798	P	axis specification
GO:0009889	P	regulation of biosynthetic process
GO:0009908	P	flower development
GO:0009943	P	adaxial/abaxial axis specification
GO:0009947	P	centrolateral axis specification
GO:0009955	P	adaxial/abaxial pattern specification
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010865	P	stipule development
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022414	P	reproductive process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048366	P	leaf development
GO:0048367	P	shoot system development
GO:0048608	P	reproductive structure development
GO:0048731	P	system development
GO:0048827	P	phyllome development
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0061458	P	reproductive system development
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0090567	P	reproductive shoot system development
GO:0097353	P	centrolateral pattern formation
GO:0099402	P	plant organ development
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network