result

Gene information

Detail information of g524453

Location

Gene	Chr	Start	End	Strand
g524453	Scaffold_91053:HRSCAF_474139	13858	14867	+

Sequences

CDS

Protein

Gene

>g524453.t1
ATGAAAGAAAGACAAAGATGGACAGCTGAAGAAGACGCCTTATTACGTGCATATATACTTAAACACGGGCCAAGAGAATGGAACCTCATATCACAACGCATGCACACAGCTTTTCATAGAGATTCAAAATCTTGCTTAGAAAGGTGGAAAAACTACCCAAGTCCAAACATCAAAAGGGGATCTTTAAGCAACGAAGAACAACGGCTCGTTATACAACTCCAAACAAAGTACGGAAACCAGTGGAAGCAAATCGCAACAGAAGTTCCAGGTCGAACGGCTAAAAGGCTAGGCAAGTGGTGGGAAGTCTTCAAAGAAAAACAAGAAAGGTTGAAGGAAAATAACACTAGCGTGGCAGAGAGTATTGAGCCGAAAAAGTACGATCACATTTTGGAGAACTTTGCGGAAAAACTGGTTAGAGATAGAGAAAACATAGAAATAGTAATGTCAGCACCAATATTTCCTTCATGGCTTTCAAATTCTAACAGTCCTCCTTCACCAAATGTGGCTCTTACGTTGTCTCCTTGTGGTGATAATAATAGACACGGTGTAATTTCTGGGCCTCCTTCAGCTGATAGTAGCCTTGTGTATGACCTGACTGAGTGCTGCAGAGAATTGGAAGAAGGGTAATATTGATTTCATTTTAAGTGGAGTATAATAATACACAAGTGTTTCTTAGTCTTCTTCTTATTATTATTGTTTGTTTAAGATATCAAGCACTGGTTGCACACAAGAAAGAAACTTCATGGAGGCTGAGGAGGGTGGAACTACAGCTGGAATCCGAAAAGGGGTCCAAGAAGAGGGAGAAAATAGAAGAAATAGAAGCAAAGATACGTGCACTAAGAGAAGAGCAGGTGGTAGCTTTAGATAGAATCGATGCAGAGTACAAAGAGCAAATAACGCGTCTTAAAAGAGACGCAGAAGCAAAAGAGCAGAGGCTTGCGGAGCACTGGGCTGCAAAGCATGCAAAACTTGGCAAGTTTTTTGAGCAAATGAATGGGAATCAATGGTAG

Functional annotation

Database	accession number	e-value	annotation
nr	BAM08930.1	5.8e-115	asymmetric leaves1
Swissprot	O80931.1	1.6e-82	Protein PHANTASTICA
trEMBL	I0IUI1	4.1e-115	Asymmetric leaves1

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G37630.1	50.42	7e-95	343	AS1;ATMYB91;ATPHAN;MYB91	myb-like HTH transcriptional regulator family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g524453	AT2G37630.1	361	123	4	1	305	1	361	50.42	7e-95	343
g524453	AT5G40330.1	111	64	1	7	117	17	125	40.54	2e-20	96.3
g524453	AT5G14750.1	109	62	1	7	115	21	127	41.28	1e-19	94.0

Ortholog group

Species	Genes
Allium cepa	g524453.t1
Allium fistulosum	AfisC2G03344
Allium sativum	Asa0G04536.1; Asa2G05586.1; Asa2G05587.1; Asa4G03356.1; Asa5G02696.1; Asa5G02697.1; Asa7G02053.1; Asa7G04600.1
Arabidopsis thaliana	AT2G37630.1
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF13921.3	Myb_DNA-bind_6	Domain	7	68	52.1	5.3e-14

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0000988	F	transcription factor activity, protein binding
GO:0000989	F	transcription factor activity, transcription factor binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0001076	F	transcription factor activity, RNA polymerase II transcription factor binding
GO:0001134	F	transcription factor activity, transcription factor recruiting
GO:0001135	F	transcription factor activity, RNA polymerase II transcription factor recruiting
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0044212	F	transcription regulatory region DNA binding
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09422	MYBP; transcription factor MYB, plant	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network