result

Gene information

Detail information of g528738

Location

Gene	Chr	Start	End	Strand
g528738	Scaffold_91554:HRSCAF_474640	453847	454983	-

Sequences

CDS

Protein

Gene

>g528738.t1
ATGAGCATATCTGTTAATGGACAATCCAGCGTGCCGCCTGGCTTCCGCTTCCATCCAACCGAAGAAGAGCTTCTCAACTATTATCTCAGAAAAAAAGTAGCTTCTGAAAAAATCGATCTTGATGTCATTCGTGAAATCGATCTCAACAAACTCGAACCCTGGGAGATACAAGGTATGTATGTAGGGACTATACTAATAACAACTTTTACTCCATATCACGATAGAGTTTATAAGTTAACTGTGTTCATGATGGATCAGAAAAGTGCAAAATTGGAACTACGCCCCAGAACGACTGGTACTTCTTCAGCCATAAAGACAAGAAGTACCCTACAGGAACAAGGACCAATAGGGCAACAGCTGCAGGTTTCTGGAAGGCTACCGGCCGGGACAAAGTAATTCACACCAGCCTGAAAAGGATAGGCATGCGAAAAACGCTTGTGTTTTACACAGGCAGAGCACCGCATGGTCAGAAATCGGACTGGATCATGCACGAGTACAGACTCGATGAGTTACATTTTAACTCCATGGTAGTTGTATTTCCATGTGTATATTCTTGGCTCTCAAAATCTTTTGTATGTGTCTCTATATATGTAATATGATGCTGTTGTTTAATTATAGGCTGCAAGTTTGATTCAGGAAAGCATGAACCAAGAAGAGGGATGGGTGGTTTGTCGCGTGTTCAAGAAAAAGAACTTTCTTCACAAGTCTTCTGACACTTCTAACTGCTCATCGTCTAATTTGATGGCCATCACCAACGATGGCACTCTGGACCAGATCATTCAATGCATAGGAAGATCTTGCAATCAAGAATCAGCAAGTAAAAGCATGGTAGCAGGTTCGAGAAAGCCTCTCTACAGTGAAAGATTCATGAAGCTTCCGGCACTTGAGAGCTACCATCAGCAAGAAAGCATGAATGCAACGGTGATATACAACGACTGTGGTTATCATCCTGATGTGGCACTTAATGATTGGACGACCCTGGATAAGCTCATTGCCTCTCAACTTAACGGCCAGTTTGACGCGAAGCAGATCATGTGTTTGGATGACACGGCTACTATGCTTATTGATAATGAAGAAGAAAGCAGCGGCAATGGTGATCTCTGGAGCTTGGCATCTTCGGCCCCTGATCGCATGTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020243907.1	3.3e-105	NAC domain-containing protein 43
Swissprot	Q84WP6.2	1.5e-91	Protein NAC SECONDARY WALL THICKENING PROMOTING FACTOR 1
trEMBL	A0A5P1FSM8	2.4e-105	NAC domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G46770.1	59.54	1e-94	343	ANAC043;NST1	NAC (No Apical Meristem) domain transcriptional regulator superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g528738	AT2G46770.1	304	79	7	1	278	6	291	59.54	1e-94	343
g528738	AT3G61910.1	293	95	5	1	278	1	276	56.66	1e-86	316
g528738	AT1G32770.1	300	113	7	1	277	6	301	53.33	1e-83	306

Ortholog group

Species	Genes
Allium cepa	g15570.t1; g29000.t1; g528738.t1
Allium fistulosum	AfisC1G01385; AfisC2G05781; AfisC2G07753
Allium sativum	Asa0G01256.1; Asa0G01257.1; Asa0G04548.1; Asa0G05434.1; Asa0G05880.1; Asa0G05881.1; Asa5G03039.1; Asa5G03291.1; Asa6G01300.1; Asa6G01318.1; Asa6G01329.1; Asa7G01340.1; Asa7G04707.1; Asa7G04708.1
Arabidopsis thaliana	AT1G32770.1; AT1G33280.1; AT1G79580.1; AT1G79580.2; AT1G79580.3; AT2G46770.1; AT3G61910.1; AT4G10350.1
Oryza sativa	LOC_Os02g15340.1; LOC_Os06g04090.1; LOC_Os06g33940.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF02365.12	NAM	Family	12	139	98.5	2.7e-28

Gene Ontology

Accession	Ontology	Name
GO:0000003	P	reproduction
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009832	P	plant-type cell wall biogenesis
GO:0009834	P	plant-type secondary cell wall biogenesis
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009900	P	dehiscence
GO:0009987	P	cellular process
GO:0010047	P	fruit dehiscence
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022414	P	reproductive process
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032504	P	multicellular organism reproduction
GO:0042546	P	cell wall biogenesis
GO:0044085	P	cellular component biogenesis
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048609	P	multicellular organismal reproductive process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071554	P	cell wall organization or biogenesis
GO:0071669	P	plant-type cell wall organization or biogenesis
GO:0071840	P	cellular component organization or biogenesis
GO:0080090	P	regulation of primary metabolic process
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network