result

Gene information

Detail information of g529529

Location

Gene	Chr	Start	End	Strand
g529529	Scaffold_91632:HRSCAF_474718	71539	72927	+

Sequences

CDS

>g529529.t1
ATGGCATCATCCTCTTCTACCTTCCTTTATCTCTTTCATCATCCTCCCACCTCTTCCTTCATCAACTCCACTCTTTCCCCTCAAGAGGAAGAAGACCTCTTCAATCTTTGCTACTCTCAAAATCTTAAATCATTTCATTATAATTCCCCAGAAACCACAAGAATGGTTCGCAAAAGACCCATTTCCGAAATCTCATCCAACCCAATCCCTCCTCCTCCTGCTACCCATCATCAACCCATTTGCGACTTTTCGGGTCTTCCCCTTTTTGTTGCGCCAACAGAACCGGTTCCGATACAAAGCAGCACCATCCCCATTGAAAGCGGTAACGTTACCACCATCAACGCAAACCTTAACGCAAACAATAACATATCTGTCGATGCAATCATAAGAGACCTCATTAACAACGCTTCGCCTGAGGTGACCATACCGCAGATCATTCAAAACGTCCGAGATATCATCCATCCGTGCAACCCAGGTTTAGCCAGCGTTCTCGAAAACCGCCTTCGCGGTTTGATTTCCGATCTCCCTCCTACCGGTGGGGCGCCGGAATCCTCTAACAAGAGAAGAAGGGAAGGCGACCATACCACAGAAATCGCGGTCGAGTTACCTCCGCCACAACCACAAACTAATAATAACGACAATGCCTCAACTTCTACATCGCAGCAGCAGAAAAGCACGAATGATAACCAAGAGATGAACCGAAAGCAGAAGAGAGACGAAGAGGGACTACATCTCCTAACTCTTCTCCTACAATGCGCAGAAACAGTGGCATCCGAAAATCTAGTGGAAGCAAACAAATTACTTTTAGAAATTTCGGAGCTTTCAACTCCCTATGGCACTTCAGCGCAAAGAGTGGCAGCTTATTTTTCAGAAGCAATGTCAGCAAGGTTAGTCAATTCGTGTTTGGGGATATCCGCAGCTCTCCCTATAATCCCACATCGTCAGAAACTAGCTTCCGCCTTCCAAATATTCAATGGCATCAGCCCGTTCGTAAAGTTTTCTCATTTCACATCAAACCAAGCAATCCAAGAAGCGTTTGAGAGAGAGGAGAATGTTCACATTATAGATCTGGACATAATGCAGGGACTTCAATGGCCCGGACTATTTCACATACTCGCTTCAAGGCCCGGCGGTCCGCCCAGAGTTAGACTGACAGGTCTGGGGAACTCGACGGAGGCACTAGAGGCGACGGGGAAGAGATTGAGTGATTTCGCGGAGACCTTAGGGTTGAGTTTTGAGTATGTTGCTATTAATGGAAAGATTGGGAATTTAGATGTGGAGAGATTAGGAATTAGAAGGAGGGAAGCTGTAGCTGTGCATTGGTTGCATCATTCTTTGTATGATGTTACTGGGTCTGATGGTAGTACACTCAAGCTGCTGCAAAGGTAA

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020598478.1	4.1e-117	protein SCARECROW
Swissprot	Q9M384.1	9.9e-108	Protein SHOOT GRAVITROPISM 1
trEMBL	A0A2I0VDU0	8.7e-117	Protein SCARECROW

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G54220.1	53.32	6e-118	421	SCR;SGR1	GRAS family transcription factor

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g529529	AT3G54220.1	482	138	11	55	462	43	511	53.32	6e-118	421
g529529	AT5G41920.1	253	111	4	225	462	12	263	49.80	2e-63	240
g529529	AT1G50420.1	207	121	1	237	439	46	252	39.61	2e-34	143

Ortholog group

Species	Genes
Allium cepa	g529529.t1; g529530.t1
Allium fistulosum	AfisC7G04477
Allium sativum	Asa3G01451.1
Arabidopsis thaliana	AT3G54220.1
Oryza sativa	LOC_Os11g03110.1; LOC_Os12g02870.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03514.11	GRAS	Family	246	458	233.0	4.5e-69

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001708	P	cell fate specification
GO:0003002	P	regionalization
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0008104	P	protein localization
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007275	P	multicellular organism development
GO:0007389	P	pattern specification process
GO:0008150	P	biological_process
GO:0008356	P	asymmetric cell division
GO:0009605	P	response to external stimulus
GO:0009606	P	tropism
GO:0009628	P	response to abiotic stimulus
GO:0009629	P	response to gravity
GO:0009630	P	gravitropism
GO:0009889	P	regulation of biosynthetic process
GO:0009956	P	radial pattern formation
GO:0009987	P	cellular process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0032507	P	maintenance of protein location in cell
GO:0033036	P	macromolecule localization
GO:0033365	P	protein localization to organelle
GO:0034504	P	protein localization to nucleus
GO:0034613	P	cellular protein localization
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0045165	P	cell fate commitment
GO:0045185	P	maintenance of protein location
GO:0048366	P	leaf development
GO:0048367	P	shoot system development
GO:0048731	P	system development
GO:0048827	P	phyllome development
GO:0048856	P	anatomical structure development
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051179	P	localization
GO:0051235	P	maintenance of location
GO:0051252	P	regulation of RNA metabolic process
GO:0051301	P	cell division
GO:0051457	P	maintenance of protein location in nucleus
GO:0051641	P	cellular localization
GO:0051651	P	maintenance of location in cell
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0065008	P	regulation of biological quality
GO:0070727	P	cellular macromolecule localization
GO:0072595	P	maintenance of protein localization in organelle
GO:0080090	P	regulation of primary metabolic process
GO:0090610	P	bundle sheath cell fate specification
GO:0097159	F	organic cyclic compound binding
GO:0099402	P	plant organ development
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network