result

Gene information

Detail information of g533302

Location

Gene	Chr	Start	End	Strand
g533302	Scaffold_92034:HRSCAF_475120	138316	140192	-

Sequences

CDS

Protein

Gene

>g533302.t1
ATGAGCGGAAGCAGTGGAACAGGAGGAGGAAGTGGAGGAGGAGGAGGCGGGCCATGTGGAGCCTGCAAGTTTTTAAGAAGGAAATGTGTGACCGGCTGCATATTTGCTCCTTACTTCGATTCTGAGCAAGGCGCCACTCATTTTGCAGCTGTTCATAAAGTATTTGGTGCCAGCAATGTTTCAAAGCTCTTGTTGCATATTCCGGCGCATAAAAGACTCGATGCTGTTGTTACTATTTGTTATGAGGCACAGGCCAGGTTGCGTGATCCTGTTTATGGTTGTGTTGCTCATATCTTTGCTTTACAACAACAGGTTCGTTTGAATTTGATTTAGTTTGATTTTGTTAAAGTGATGGTGAATTGGTATAAGTTTTAATTGGTAATAGCTTTTTTGATGTGGTTAACTTGTGGGTTTTGTTTTTTTTTTCCCTTCCAATCTCTCTTTTGTGTAATTTGAACATGATTTATTGATTAGTGGTGATTTTTCTGCTTTTGTTTAATTTGTTAAGGGCTTTTGTTTAATTTGTTAAGGTGGTGATATGATATATGCTACCTTTTTTATTTTTTCATTTTTATTATCTTTGAATAATGGACTATTGAAATATAAATAAGAGTATTTTGAATTGTGAATAGTTACTCTTCATTTTGGAAATCGAATTCGATCGATTTGATTCATATAGGGTAATCTTCATTTTATTTCCTTAGGTAAAATTCTATGTACCATAAAAGTGAAATTTGTCAATGAGTTTATTTCCTTGTGCAAAATTCTATGTACCATAAAAGTGAAATTTGTTACCGACTTTAGAAAGCTTTTTTTATTTTAGTTTTCCTTCTGCATCCTTTGGTATGTATCTTCATTTTAATAGTCAATGTAAAGAGAATAGATTGGCATATTTAAACCTATCGCTTTATCTAGCTATGTCAGTCAAAACTCATGCATAAACTATGAATTACAATTTGGGCACCAGATCAAGAAGGATATGATGTTTGGTCAATACACAATTTTACCTTCCCAATAAATGGTAAACTTTGAAACTACTATATAGTCTGTATAAGAACATATGAGAGGTAATAATAATAATTAGGGTTTGTGATATTAGTTTATACACTACAGCTAGTTTGTTATTCCATCACAATTAAAGTTAGTTGTTATCATGTTGCAACTTGTTTCTTCCAAAAATCGCAGATCTAATCTTGAATTTGGAATGAGTCGTTTTCTGTAACTGATGCTAAAAGAAGAAGAAGAGACTCACAAGTAAAGCAATCAATTTTCTCCCACATTTTTTTTTATCAAAGAAGTAAATTTAGGGCACACGCTAACAAATACCGCCTTTTCTTAATTACATAAGCTCACATCCACATAATTCATTTTATTATTTCCCCAGTATGAACAAATTTGTTCAACGTTTCATTTAACCAACGTCAAACCAATATTTATTCAAAAAACTTGGAATGTTGTTTTTGTTTCTAATACACAATTTACTTGTACATCTAAATTATTCACAGGTGGTAGGTTTACAGGCTGAACTTTCTTACTTACAAGCTCACTTAACACAACTCGAGCTTCCATCTCCTCCTCCACCACCACCAATTCCCACTGTAATCTCTGCACCATTTTCAATCTCGGACTTACCATCATCTTCCCACTTGCCATCGAATCTTGACCTTTCCGCATTATTCGATCCAATGGTCCAACCGACATGGAATATTCATCAACAAAGTACCCAACAACAAATGATTGAAAGAAGAAATAGAGAGAACATCGAGGAGAGCTCAAGTACCATTGCTGGTGGTGATTTGCAAGCTCTTGCTAGGGAACTTCTTGATAGACATCAATCGAATGCACCGCCTGCTGATTCTCCTCCGACTTCCAAATAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_009400358.1	1.3e-68	PREDICTED: LOB domain-containing protein 18-like
Swissprot	O22131.2	4.1e-54	ASYMMETRIC LEAVES 2-like protein 20
trEMBL	A0A804J377	9.6e-69	(wild Malaysian banana) hypothetical protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT4G00220.1	61.43	1e-58	223	JLO;LBD30	Lateral organ boundaries (LOB) domain family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g533302	AT4G00220.1	210	70	4	19	226	18	218	61.43	1e-58	223
g533302	AT2G45420.1	218	64	5	18	220	37	250	61.93	3e-58	221
g533302	AT4G00210.1	215	85	4	10	213	3	208	51.16	2e-48	189

Ortholog group

Species	Genes
Allium cepa	g533302.t1
Allium fistulosum	AfisC5G05231
Allium sativum	Asa6G05277.1
Arabidopsis thaliana	AT2G45420.1
Oryza sativa	LOC_Os03g14270.1; LOC_Os10g07510.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03195.11	DUF260	Family	18	116	133.1	3.4e-39

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007275	P	multicellular organism development
GO:0009653	P	anatomical structure morphogenesis
GO:0009888	P	tissue development
GO:0008150	P	biological_process
GO:0009791	P	post-embryonic development
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0010015	P	root morphogenesis
GO:0010087	P	phloem or xylem histogenesis
GO:0010089	P	xylem development
GO:0010101	P	post-embryonic root morphogenesis
GO:0010102	P	lateral root morphogenesis
GO:0010311	P	lateral root formation
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0048646	P	anatomical structure formation involved in morphogenesis
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022622	P	root system development
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048364	P	root development
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048527	P	lateral root development
GO:0048528	P	post-embryonic root development
GO:0048731	P	system development
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0099402	P	plant organ development
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0090696
GO:0090697
GO:0090698
GO:1905392
GO:1905393

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K21994	LBD18; LOB domain-containing protein 18	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network