result

Gene information

Detail information of g53385

Location

Gene	Chr	Start	End	Strand
g53385	CHR1	45283370	45284546	+

Sequences

CDS

Protein

Gene

>g53385.t1
ATGCCGCCCCTCGATACATTTAAACTTCTGCAATTCGTAGTGTCTATCAGCTTCTACTCAAAATGGCGTCTTTTACCAACTTCTTCATGGTTGTTGTACTCTCCAGAACAATACTTCCGCTCAGACGAATGGTAATACAGTTCTATGTAATTGATTTTATACAAATTCAATGATAGATCTTTGTTTCCATGGGTAGAGCAAAGGCGGATGCATTGAAAAAAGGAGATTCGAAGTGAGTTCGTTACTATTTAATTAATTTTGGGGATTTTTTATATCTGTTTCGTATCCGATTTCAGAACTAGGTTTTGATTTGTAATTTCTCTGATTACGCAGGGTCTCTGTGAAAAGGAAGGCGGCTGAAAAGCCAAAGAAGCAGCCGGTGAACAAGGCTAAGGCTGAGAAGGATCCCAACAAGCCTAAAAGACCCCCTAGCGCCTTCTTTGTTTTCATGTAATTTTCCTATACCTTTGTTTTATTATGTTTTTTGGTTGTTTGTCTTAAGGTTTCAGAATCTGTAATTTTAGGGAAGCATTTAGGAAGCAGTTTAAAGCGGAGAATCCTGACAATAAGCAAGTTTCAGCTGTGAGTGGTTATGAATCAATTGTTTGGTATCTTGGTTGAATTTTAATTTCCGATTAGTCAGAACTCTTTGTTTGGTGAATTAGGTCGGTAAAGCAGCGGGCGAGAAGTGGAAATCTATGTCAGCTGCCGTGAGTTGTATAGGAAAGAGTAATCCGTACAATATTTGGAAAATTAATCTGTAGATCTAGAATTTTAATTTTACAATTTATAGGATAAAGCACCTTACGAGGCAAAGGCAGCGAAAAAGAAGACTAAGTATAACAAAACCATGGTCGCTTACAACAAAACACTGGTATGAATACCGTGCTACTAAAGTTACATCACTCTACATCTTTTGTGTCTTTATCAACTGAATGATTAACAATAAGCCATTTGCGTTTAGTCCGATGGAGCAAGCAAAAAAGCTGTAGTTGAAAAGGAAGAGGAAGAGGAGTCTGACAAATCCAAATCTGAGGTTCATGACGAGGACGACGGTGAAGACGATGAAAGTGGAGAGGTAATACTCTAAATTTAGAGAACAAATATATTTGTCAATATTCATGGCTCAAATTGTAATCTGTGTTTTCTTTTTCAGGAAGAGGAGGACGATGATTAA

Functional annotation

Database	accession number	e-value	annotation
nr	KAA8547591.1	6.6e-29	hypothetical protein F0562_004020
Swissprot	P26585.1	3.2e-28	Protein SB11
trEMBL	D6MKP4	4.0e-36	Transcription factor

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G51880.2	58.87	2e-33	139	AtHMGB1;HMGB1;NFD1	high mobility group B1

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g53385	AT3G51880.2	141	45	3	36	174	15	144	58.87	2e-33	139
g53385	AT1G20693.2	145	46	3	43	187	13	142	57.93	2e-33	138
g53385	AT3G51880.3	141	45	3	36	174	15	144	58.87	3e-33	138

Ortholog group

Species	Genes
Allium cepa	g292060.t1; g53385.t1
Allium fistulosum	AfisC3G05992
Allium sativum	Asa2G04975.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00505.16	HMG_box	Domain	72	141	81.4	4.2e-23

Gene Ontology

Accession	Ontology	Name
GO:0051276	P	chromosome organization
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000785	C	chromatin
GO:0001067	F	regulatory region nucleic acid binding
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003682	F	chromatin binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006333	P	chromatin assembly or disassembly
GO:0005198	F	structural molecule activity
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005694	C	chromosome
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006325	P	chromatin organization
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006996	P	organelle organization
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0044212	F	transcription regulatory region DNA binding
GO:0016043	P	cellular component organization
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0030527	F	structural constituent of chromatin
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043228	C	non-membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043232	C	intracellular non-membrane-bounded organelle
GO:0044422	C	organelle part
GO:0044424	C	intracellular part
GO:0044427	C	chromosomal part
GO:0044446	C	intracellular organelle part
GO:0044464	C	cell part
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071840	P	cellular component organization or biogenesis
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K10802	HMGB1; high mobility group protein B1	EC:-	Base excision repair	ko03410
			Autophagy - animal	ko04140
			Necroptosis	ko04217
K11296	HMGB3; high mobility group protein B3	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network