result

Gene information

Detail information of g60404

Location

Gene	Chr	Start	End	Strand
g60404	Scaffold_31916:HRSCAF_299541	709675	710784	-

Sequences

CDS

>g60404.t1
ATGCTAGGCTCACTAAAATCCACTGATGTTCATCATTCTTCTCGTAAACTTCTGATAAGTTGCGCTGAGCTGGTACATCGTTCTGACCTACCATCAGCACGCCAGGTTTTATCAGAACTCCTTTCCTCTTCAAATAATTTTCAGTTTGGCGACTCTAATGATCGCTTAATCCATCAATTTGCTTTGGCTCTATCTCTTCGTCTCTCAATATTCCCTCTCTGCCCTCAAATAATAGACCAGAAAGCATTGCAATCTTCATACTTGTCCCTCAATCAAATCACACCTTTTTTACGTTTCGCTCATCTAACAGCTAACCAAGCAATCCTCGAATCCTTACAAGGATCCAATGCCATCCATATTCTAGACTTTGACACTTCTCATGGCTTGCAATGGCCACCTTTGCTTCAAGCCATTGCTGCACTATCCGATCCACCATCCATTCGCATAACGGGAACTGGGTGTGCCGACTTATCAGTCTTGCATAGAACAGCTGATCGGCTAGAAACATTTGCAGCGTCACTAGGGTTGCACTTCAAGTTTCATATCAGCACCGGAAGCAACTTTGAGATTCATCAAGGCGAAACCCTAGCTGTGAATTGCGTGAACTTCTTGAACAGATTCATGAAAGATGGCGACAGTGGAGATCAAGAAGTTCGAAAGTTTCTTTATGCTGTTAAGGCAATGAATCCTGCTGTGTTAACTGTAGCTGAAAAGGAAGCGAGTCATAGTTCGCCTATTTTCTTGCAAAGGTTTATGGAAGCTTTGGAGTATTACAATGCAGTGTTTGAATCTTTGGAAGCAACGGTTCCACCAAGTAGTAGAGAGAGGTTGGAAGTGGAGCAAGTTTGGTTTGGAAGGGAAATAAGCGACGTGGTTGCTTTTGAGAATGAAAGGAGAAGAGAGAGGAGTTTGAAGTTTGAGAAATGGGAGCAAATTATGAAGGGAGTTGGGTTTAAAAGTAAAGCTTTGAGTCCTTTTGCGCTTTCACAAGCGAGGCTGTTGCTCAGGTTGCATTACCCATCCGAAGGTTATCAGTTGAAGTCTTTGAGGGATGCCTTTTTTCTTGGTTGGCAAAGTACTCCTCTCTTCTCAGTTTCATCTTGGTTTTAG

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	XP_009388384.2	1.9e-125	PREDICTED: protein MONOCULM 1
Swissprot	Q9ZWC5.1	2.5e-85	Protein LATERAL SUPPRESSOR
trEMBL	A0A804IB01	1.4e-125	(wild Malaysian banana) hypothetical protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G55580.1	46.00	4e-85	311	LAS;SCL18	GRAS family transcription factor

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g60404	AT1G55580.1	413	160	11	12	368	39	444	46.00	4e-85	311
g60404	AT1G63100.1	343	198	8	55	368	314	653	32.94	4e-51	198
g60404	AT1G66350.1	368	202	14	18	368	156	505	35.60	4e-50	195

Ortholog group

Species	Genes
Allium cepa	g60404.t1
Allium fistulosum	AfisC4G05747
Allium sativum	Asa5G04742.1
Arabidopsis thaliana	AT1G55580.1
Oryza sativa	LOC_Os02g10360.1; LOC_Os06g40780.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03514.11	GRAS	Family	15	368	350.7	7.8e-105

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0009653	P	anatomical structure morphogenesis
GO:0009888	P	tissue development
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009933	P	meristem structural organization
GO:0010014	P	meristem initiation
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048507	P	meristem development
GO:0048532	P	anatomical structure arrangement
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network