result

Gene information

Detail information of g60588

Location

Gene	Chr	Start	End	Strand
g60588	Scaffold_31944:HRSCAF_299904	167292	168604	-

Sequences

CDS

Protein

Gene

>g60588.t1
ATGTTTCATTCTACCTCCCCATACTATGAATTAGACTCCTCTTCAGTTGCATTTTTTGATGGTGTAACTCTTCACTCCACATCTTTGCCTTCTAATGATAATATTTACATGCACCGAAGTAACAGCACCCACTCTTTCACCCACAGTCAAGCTTGCAGTGGCCCGGACCTACCCTCTAACCTTTACTTTTCTTCTTCTTCACCCTCATCTGCTTGTGAATTTCTCGATTTCTCTAATGAGCCTGTCAGAAGGGTTTTAAGCACGGGTGACCTTCAGGTAACAATTTATTATTTTGCATATTCTTGCTTATGAACTGTAATAAAATTGAATTGTACAATTTTATATCTTCGCAGGCTACAGCAGAGAATTGTACGCAAGAAATTGCACGTGTAGGGAGATACAGTGCAGAAGAAAGGATGAAGAAGATTGAAAAGTACAGAAACAAGCGAAACCAGAGAAATTTTCAGAAGAAAATCACTGTAATGCTCTCTTCTTATGCTTACACTTTGCAGTGGTTTGTTTATAATCCTTTATTGTTTTGAGCTACTTTCCCAAATACACACACACACACACACACATGTATAGACGCGTATATACACATATATACATGTATACATGTATATATACACATATATTTTGAAACATATATATGACAAATGTATGCCATTTTTTTTAGGCATGAAAAAGGAGTGGTTTATTTATATATTTGCCTAATTTGAAATTAAGCCAATACAAATTTTTTCTTGAAAATATGTGATAGTGCTATTTCAAATTCTTTTCTGAAAATTACACCAATTTTTTTTGCTTTTCTTAAAGGAAAAATGAGTGCTAGTGTATATTTTGTACCAGTATCATTGTAAACAGTATCAGCACTCTTTTTCAGATTTAAATATGCGCATTTTTTATTTGTAATATATTTTCAAACTGGTATGTATGTCTGTAAAATGTTTGCAACATGATCCAATGCTAACCCAATATCACGTGATCAGTACGCGTGTAGGAAAACACTAGCAGACAGTAGACCAAGAGTCAGAGGGCGATTTGCAAGAAACGGCGAGACAGAGGCAGAAGCAGAGACAGAGACATCGGGAATTAGCTACGAAGCTTGCAACAACCATCAAATAAACAATAACGATCATGAAAATTGTAGAACTTATAATAATCATGGCGTAACTAACAATGGAAATAATGTTGCTGATGGTTGGTGGAGGCAAATGCAGTCGGTTCTTATGGAGGAGGCAGAAGGAAGTTGCTATGTGGACGATGAATTATGGACCATTGAGAACATCTTTTCTATGAATCTTCTCTCTTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020252303.1	1.3e-32	two-component response regulator-like APRR5
trEMBL	A0A2H9ZYY6	1.9e-30	Zinc finger protein CONSTANS-LIKE 4

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G41380.1	49.38	3e-27	118		CCT motif family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g60588	AT5G41380.1	162	56	6	18	158	104	260	49.38	3e-27	118
g60588	AT1G63820.1	104	28	1	77	158	134	237	51.92	6e-22	100
g60588	AT1G04500.1	54	15	0	104	157	279	332	72.22	8e-19	90.5

Ortholog group

Species	Genes
Allium cepa	g132954.t1; g344875.t1; g36976.t1; g388049.t1; g44289.t1; g60588.t1; g85622.t1
Allium fistulosum	AfisC1G00385; AfisC2G07880; AfisC2G08904; AfisC3G06008; AfisC4G04484; AfisC5G03878; AfisC6G01056; AfisC6G04531; AfisC7G01250; AfisC7G02260; AfisC7G03562; AfisC7G06114; AfisC8G03149; AfisC8G05459
Allium sativum	Asa7G00839.1; Asa8G05268.1
Arabidopsis thaliana	AT1G63820.1; AT5G41380.1
Oryza sativa	LOC_Os01g61900.1; LOC_Os05g38990.1; LOC_Os12g01080.1; LOC_Os12g16160.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF06203.11	CCT	Motif	113	155	65.8	2.4e-18

Gene Ontology

Accession	Ontology	Name
GO:0005515	F	protein binding
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0042802	F	identical protein binding
GO:0009314	P	response to radiation
GO:0009416	P	response to light stimulus
GO:0009628	P	response to abiotic stimulus
GO:0009889	P	regulation of biosynthetic process
GO:0009909	P	regulation of flower development
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048580	P	regulation of post-embryonic development
GO:0048831	P	regulation of shoot system development
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000026	P	regulation of multicellular organismal development
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000241	P	regulation of reproductive process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network