result

Gene information

Detail information of g60765

Location

Gene	Chr	Start	End	Strand
g60765	Scaffold_31992:HRSCAF_300499	392490	393674	+

Sequences

CDS

Protein

Gene

>g60765.t1
ATGGGAGATCGCAATCCAAATGATATACCCCCAGGTTTCCGATTTTACCCCTCTGACGAAGATCTTGTGGTTCACTTTCTTGCTCGAAAAGCCTCACACCTTCCTTGTCAACCCAACATCATTCCTACTCTTGATCTCCATAATTTTGATCCATGGAGTCTTTATGGTATTTCATCAGTATATGTATATTTTATAGCTAAATGTATACTATAGTTCATTCAATTATATCATTATGTGTGCATATATATAGGTAATGCTCTTCAAGGAGGCAACCAAGTGCATTACTTCTTCGCTCGCAACACCCAACATAGAGCTACACCAAGCGGGTACTGGAGCCCCATCACCGTTGATGAATCCATAATGAACAGTGATCAAGTTATCGTGGGCTTTAAAAGAACTCTTATGTTCTATTTCGGCGATATGAAGACTAATTGGGTAATGCATGAATACCATTTATCAGATGCTATCGTTAACAACACTAGAAGATCTTCCAAGAAGAGGGGAACTTCAAGAATTGTAAGTTCTCTTGCATTATATACAATTACTTAATATCATAGAAATGTTAGTGGGCGATTTCTCAATTTTTCTTAAAACTCTGCCTATTGTATGTTACATTCCCCTTATTCAGACACTTATTATTATTAGCAACTTTGTAAAACACAACCTTTATATTTTGAAATACACGGCTGTCCCTCCTAAAACAAGTCTTAAAAGACACCGCCGTTTTTAGTTTCAGTCAAACTACAAATATTGCCGGTTTCGAATTAAAACCACAAATATTGGTACTTTTTCGACAGAAAATTCACAAATAAAAAAAGTTTGTTCGATTAAATCCAAATTTAATTTCTGAAAAAATGAAAAGGATAATTTTAGAGGTTATTTAAAACATGTTTTTAACTGTTTTTCGTGTACCAAAATTGAAAATAAGGACAGATCCAAATTCCGCGTATTATTATCAAAAGCCTTCTGGGCAACATTATTCTCTAATTAATATGTATTCATAGTAATATATAACTAATCGTTGGATATTAACTATAGGAAATCAACAAATGGGTGATTTGTGGAGTATACGAATCATCATGTAATTCACATTCGAACCATAACGATGGAGGACGAGAGCTTTCATGCTTGGACGAAGTGTTCTTATCATTTGACGATCTTGATGAAGTGAGCTTGCCAAATTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020246446.1	7.8e-78	NAC domain-containing protein 104
Swissprot	Q8GWK6.1	4.3e-49	Protein XYLEM NAC DOMAIN 1
trEMBL	A0A8K0HZM8	1.9e-62	NAC domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G64530.1	53.44	2e-49	191	ANAC104;XND1	xylem NAC domain 1

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g60765	AT5G64530.1	189	80	4	8	191	2	187	53.44	2e-49	191
g60765	AT1G61110.1	165	93	3	9	160	16	180	35.76	6e-28	120
g60765	AT1G69490.1	184	96	6	9	181	9	181	35.87	2e-27	119

Ortholog group

Species	Genes
Allium cepa	g60765.t1
Allium fistulosum	AfisC5G03991
Allium sativum	Asa3G02195.1
Arabidopsis thaliana	AT5G64530.1
Oryza sativa	LOC_Os02g34970.1; LOC_Os04g35660.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF02365.12	NAM	Family	10	124	79.2	2.8e-22

Gene Ontology

Accession	Ontology	Name
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007275	P	multicellular organism development
GO:0009888	P	tissue development
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0010087	P	phloem or xylem histogenesis
GO:0010089	P	xylem development
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010941	P	regulation of cell death
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0043067	P	regulation of programmed cell death
GO:0048367	P	shoot system development
GO:0048731	P	system development
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network