result

Gene information

Detail information of g73352

Location

Gene	Chr	Start	End	Strand
g73352	Scaffold_34431:HRSCAF_341395	117407	118445	-

Sequences

CDS

Protein

Gene

>g73352.t1
ATGGGTGATAGAACTAACAACTTGTTCTTGCCTCCTGGCTTTCGATTTCATCCTAAGGATGATGAAATCATTACTTCTTATCTCGTAGAAAAAGTCGCTGATCCAACTTTTAATGCAATAGTTATGGGAGAAGCTGACCTCAATAGGTCTGAGCCGTGGGATCTTCCAAGTAATATACAACTATATCATTTTTATTTATGTTACTGGTAGCTGGAAGTATCGTACAACTGTGTTCTATGTCTTATATCTCATATATTTTTGTTACTTATTGAACCAAATCTTTTTCTTTAGATGTTAGGTTTTGCTAGTTTCAGTTCCTAACTTTAATTTATAGCTTTTGTTCTAATCATAATGTGATAAATTCAGTCATTTTGTTATATATCTATGTTAACCAACTCTTGTAATTTCTAACTAAACTTGTACACGCACATGTAGTTCTAATTGGTGATAATTTTTTTGTATATATAGACTTAGCTAAATATGGAGATGATGAGTGGTATTTCTTTAGCCCAAAAGTGAGAAGATACTCAACTGGCAGTAGATCAAATAGAGCAACTGTATCAGGGTACTGGAAAGCAACTGGAAAAGATAAGGAGATTTACAAGGGCAACAATGGAAATGGGCCGCTCGTAGGCATGAAGAAAACCCTAGTTTTCTACAAAGGAAGAGCACCAAAAGGCGACAAGACTAACTGGGTAATGCATGAATTTAGGCTCGATGGAAACTACCGATCCTTAAACGTATGTACAGTAATGCCTATTTTCCAACAATGCCAAATGCATTCACGTCTATGTATACATATATTATATAGACTTTGATATTAACATACATTATACTGCTAAATTTACAGCAAGACTGGGTAGTGGTTATGGTGAAAAATAAGAAGACAAAGAAGGATTACTCGGTTGATGCCTCAAGACACGCTACTGGTTTAAGCATTAGTGATTATCCGAGTACTTATAATGAAATCTCATCCTATGAAGGTGGCAGTTCTTCTCATGACCCCCTATTTGATTTGGAGAATATATGGATCTATTGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020252214.1	9.2e-56	NAC domain-containing protein 100-like
Swissprot	Q9FK44.1	8.3e-54	NAC domain-containing protein 87
trEMBL	A0A5P1FJB1	6.6e-56	NAC domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G18270.2	65.16	4e-55	211	ANAC087	Arabidopsis NAC domain containing protein 87

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g73352	AT5G18270.2	155	45	2	10	158	21	172	65.16	4e-55	211
g73352	AT5G18270.1	155	45	2	10	158	21	172	65.16	4e-55	210
g73352	AT3G04060.1	155	47	2	10	158	20	171	63.87	1e-53	206

Ortholog group

Species	Genes
Allium cepa	g15758.t1; g230464.t1; g402158.t1; g422842.t1; g523460.t1; g69493.t1; g73352.t1
Allium fistulosum	AfisC1G08943; AfisC5G02503; AfisC5G02509; AfisC6G04754; AfisC7G01939; AfisC7G02655; AfisC7G04462
Allium sativum	Asa3G01466.1; Asa3G02772.1; Asa3G03293.1; Asa7G07167.1; Asa7G07168.1; Asa7G07182.1; Asa8G02536.1
Arabidopsis thaliana	AT2G24430.1; AT2G24430.2; AT3G15170.1; AT3G18400.1; AT3G29035.1; AT5G07680.1; AT5G07680.2; AT5G18270.1; AT5G39610.1; AT5G61430.1
Oryza sativa	LOC_Os03g42630.1; LOC_Os04g38720.1; LOC_Os06g23650.1; LOC_Os07g48550.1; LOC_Os09g32260.1; LOC_Os09g32260.2

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF02365.12	NAM	Family	11	139	93.8	7.8e-27

Gene Ontology

Accession	Ontology	Name
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network