result

Gene information

Detail information of g88680

Location

Gene	Chr	Start	End	Strand
g88680	Scaffold_36666:HRSCAF_383799	385255	386448	+

Sequences

CDS

Protein

Gene

>g88680.t1
ATGACGCCAGCGGTCGATTCGCCGTTGGAGAGGTCTCTGCCGACGCCGTTTCTGACGAAGACCTACCAGCTCGTCGAAGATCCGGCTAGCGACGACATCATATCGTGGAATGATGACGGATCTGCTTTCGTCGTCTGGAAACCTGCTGAGTTTGCCAGAGATCTGTTGCCCAAGTATTTCAAGCATAACAATTTCTCAAGCTTCGTCCGCCAATTGAATACTTATGTAAGTTTCAATTCCCTCTTCGTTTGCTTTTTAATTGAAATTTGGGAATTAATTTCTCAAAATTAATTACTGTTTTGCATAAATATATCAGGCTTCTAGAAGTGGAAATTTCTCAAGTTTCATTCAATTTCTAATTATTGCCTATTTTCTCAGTTTTGTCAGGCATTATTCCTTCTTCGGTTCATAATAATAATAATGTCAACAATAATAATAAGAAATTAACTATTTTATTCTCTAGTAATTAGTTTCTATCACAGGTATTGGTAATAATTTATATAAAGTTTCCTTATTTGATGGTAATCTGCTAGGATATTGATAAGCGTTATTGATTTAATTTAGGGATTCAGAAAAATAGTCCCAGATCGATGGGAATTCTCAAACGAATCATTTAAAAAAGGGGAAAAGCAACTCCTACGCGAAATCCAACGTCGTAAAATATCAACGCCAGCAACACCAACCACACCAACCGCCGTCGCAGCAGCGGCGGCGGTGACAGTAGCAATTCCAGCGGCGAATCTGAGTGGTTCTTCCAACTCCGGAGATGAACAGGTAGTGTCATCAAATTCATCGCCGCCGCCACCGTCCGGGACTATAGCAGCAGGTTGTTCATCGGATCTTCTAGAAGAAAACGAGAGGCTGAGAAGAGAGAATTCCAGGCTGTCCAACGAACTAGGTAAAATGAAGAATCTGTGCAGTAATATTTACTCGCTTATGTCCAAGTACGGTGGCGAATCGCCGTCCGTAGGTGCGGCCGTAGAGCTAAATTTGATGCCTAGGCAGATGTCGGAGGTGACTCAGGTGTGTACAAAGATTTTCGGAGTTTCAATTGGGTCGAAACGGGCGCGGGAGGAAGTGGAGTCCGATGTTAAGTTAGAACCGTTTGATTCGGGTTCGGGTTCGGGTTCTGGGTCGGGTTCGAACCTGCAAAGCGAGTGCATTGATAAGAGCCCGTTGGGGAAGAAAGTATAG

Functional annotation

Database	accession number	e-value	annotation
nr	QBC36001.1	1.0e-57	heat shock transcription factor B2b
Swissprot	Q9SCW4.1	1.2e-47	Heat shock transcription factor 6
trEMBL	A0A411JIK6	7.3e-58	Heat shock transcription factor B2b

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT4G11660.1	47.37	2e-64	242	AT-HSFB2B;HSF7;HSFB2B	winged-helix DNA-binding transcription factor family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g88680	AT4G11660.1	323	108	8	10	271	53	374	47.37	2e-64	242
g88680	AT5G62020.1	269	106	7	2	246	3	266	49.81	4e-64	241
g88680	AT1G46264.1	207	85	3	11	203	29	231	50.24	7e-52	200

Ortholog group

Species	Genes
Allium cepa	g88680.t1
Allium fistulosum	AfisC3G06551
Allium sativum	Asa2G05473.1
Arabidopsis thaliana	AT5G62020.1
Oryza sativa	LOC_Os09g35790.3

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00447.14	HSF_DNA-bind	Family	17	106	114.4	2.6e-33

Gene Ontology

Accession	Ontology	Name
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0042493	P	response to drug
GO:0009889	P	regulation of biosynthetic process
GO:0009890	P	negative regulation of biosynthetic process
GO:0009892	P	negative regulation of metabolic process
GO:0010033	P	response to organic substance
GO:0010200	P	response to chitin
GO:0010243	P	response to organonitrogen compound
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010558	P	negative regulation of macromolecule biosynthetic process
GO:0010605	P	negative regulation of macromolecule metabolic process
GO:0010629	P	negative regulation of gene expression
GO:0045892	P	negative regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031324	P	negative regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031327	P	negative regulation of cellular biosynthetic process
GO:0042221	P	response to chemical
GO:0045934	P	negative regulation of nucleobase-containing compound metabolic process
GO:0048519	P	negative regulation of biological process
GO:0048523	P	negative regulation of cellular process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051172	P	negative regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051253	P	negative regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1901698	P	response to nitrogen compound
GO:1901700	P	response to oxygen-containing compound
GO:1902679	P	negative regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903507	P	negative regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000113	P	negative regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09419	HSFF; heat shock transcription factor, other eukaryote	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network