result

Gene information

Detail information of g98910

Location

Gene	Chr	Start	End	Strand
g98910	CHR3	269924217	269925683	-

Sequences

CDS

>g98910.t1
ATGTGCTTTGTTCCTAAAAATCAATCCATGGACTCCTCCATGAAAATTACAAGCACCGAATCATCCTCTCTCCTCTTAGAATACGCAGCTTCCAACGACCTCTCCTCCTTCATAAACTCCCTCGGTCAACTAAATCGCAGCATCTTAACCATCCCTGCACCATGGTACTGCCGTTCTATCAGATCCGACCCCAAAATGGGTTTTGCGCTCCGAACTCCGCTTATGATCGCTGCCTTATATGGCAGCATCGATATACTGAAATACATCCTTGAATCCGACCTCGAAATCGACGTCAACCTCCGATCTGAAACCGATGGCGCCACCGCTTTCGATCTCGCCGCTGCAGGCGGCGCCAAAACCCGATTCGAAGCAATCCGTTGTCTCTCCGATTTCCTTCCTGCAGATTCAGTTTCAGCTCACAATTTTCCAGATCTGGAATCCAGCCTCAAATCTACCGTTGCGATTGAAAACAAGAAGAAAGAGTACCCGTTGGATCTAACGTTACCAGACATCAAAAACGGGCTGTACGGAACGGATGAGTTCCGTATGTACACGTTCAAAGTGAAGCCCTGCTCCAGAGCTTATTCTCACGACTGGACGGAGTGCCCTTTCGTGCATCCAGGCGAGAACGCGCGTCGAAGAGACTTGAAAAAGTACGTCTACAGCTGCGTTCCGTGTCCTGAGTTCAGAAAAGGCACGTGTGCGAAAGGCGATAATTGCGAGTACGCTCATGGAGTTTTCGAGTCATGGCTGCATCCAGCGCAGTACAGAACTCGTCTGTGTAAAGATGAAGTCGGATGCAACCGTAAGATTTGTTTCTTTGCGCATAAAGTGGAGGAGTTGAGATCCGTTAACCCGAACGGATTAGGTTGTTCTTCTCCTACTTCCATGTCTGGTTTAGATCCCTATATGTTTGCTCCATCATCACCCGTTTCATCTCCGGGTCCTTTTATGAACACACAAATTCCAGCGCTTCAGTTACCTAACAGCCGATTGAAATCTTCGTTAAGTTTTCGAGATATTGATGTTAATATGACACTTGAGCACTACAGGCAGAACTTGATAGAGCAAATTCAGACTGTTTCATCCCCTTTATCATATGGACAGTCAATGAACCATCATATGTATAATAACTACCCATCTTCCCCGACCGTTAATTCATCATCTGCAGCCATGGCAAAGGCTATTATAAATTCTAGAGCAGCAAGTTTCGCGCAAAGAAGTCAGAGTTTTATTGACAGAGGAGCTAACTTTTCTCCTACAAAGAAAGTAAGTATGAATTGGGGATCGCCTAATGGAAAATTGGATTGGGGAATGGAAGGAGAGGAGTTGAACAAGTTTAAAAAGTCGGCGTCCTTCGCGACGAGGAAGGAGAGTAACGTTTACGAGGAAGAGCCGGATATGTCTTGGGTGCACAGTTTGATCAAGGACGAACCGGTTAAGGCAAGAGGCGAGTTTGTTTACTGA

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	RWW26928.1	3.7e-124	hypothetical protein GW17_00008666
Swissprot	Q9XEE6.1	4.0e-107	AtSZF2
trEMBL	A0A444FWD5	2.7e-124	C3H1-type domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G55980.1	43.97	2e-110	396	ATSZF1;SZF1	salt-inducible zinc finger 1

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g98910	AT3G55980.1	564	230	18	1	486	1	556	43.97	2e-110	396
g98910	AT2G40140.2	538	209	16	21	477	29	555	44.05	2e-107	386
g98910	AT2G40140.1	538	209	16	21	477	29	555	44.05	2e-107	386

Ortholog group

Species	Genes
Allium cepa	g98910.t1
Allium fistulosum	AfisC3G01801; AfisC3G07503
Allium sativum	Asa2G02885.1
Arabidopsis thaliana	AT2G40140.1; AT2G40140.2; AT3G55980.1; AT5G58620.1
Oryza sativa	LOC_Os05g03760.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF13606.3	Ank_3	Repeat	71	99	20.8	0.00031
PF00642.21	zf-CCCH	Family	225	245	23.6	3.1e-05

Gene Ontology

Accession	Ontology	Name
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006952	P	defense response
GO:0050832	P	defense response to fungus
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006950	P	response to stress
GO:0008150	P	biological_process
GO:0009266	P	response to temperature stimulus
GO:0042493	P	response to drug
GO:0009409	P	response to cold
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0051707	P	response to other organism
GO:0009620	P	response to fungus
GO:0009628	P	response to abiotic stimulus
GO:0009889	P	regulation of biosynthetic process
GO:0010033	P	response to organic substance
GO:0010200	P	response to chitin
GO:0010243	P	response to organonitrogen compound
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0042221	P	response to chemical
GO:0043207	P	response to external biotic stimulus
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051704	P	multi-organism process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0098542	P	defense response to other organism
GO:1901698	P	response to nitrogen compound
GO:1901700	P	response to oxygen-containing compound
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network