Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|672145536\|ref\|XP_008796687.1\|	1.50E-11	PREDICTED: serine/threonine-protein phosphatase PP2A catalytic subunit isoform X1 [Phoenix dactylifera]
Swissprot	tr\|Q9XGH7\|PP2A_TOBAC	6.00E-10	Serine/threonine-protein phosphatase PP2A catalytic subunit
trEMBL	tr\|K4ASG1\|K4ASG1_SOLLC	2.00E-09	Serine/threonine-protein phosphatase {ECO:0000256\|RuleBase:RU004273}

Scaffold	Start	End	Strand
GWHAAEX00000014	5448183	5449259	-

Transcript Sequence
>GWHTAAEX000037 ATGAGCACGAATCCTGGCCTGGCGAGTTCCCATGGAAACCTAGATGAGCAAATTGCTCAGTTGATGCAGTGCAAGCCGCTATCCGAACAGGAGGTTTTTCTCGGCTCAATATTCCCTGTTTTCTCTTTGGTTTGGAGCCACTCTTCTGCTATGTGTTGCACTTTTTCGCAAAACTTTGTTTTACAGATGGAGGGTAGTAGTCTCTGCACAGAGAGGGTGGAGGTTCGTTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K04382	PPP2C	mRNA surveillance pathway	map03015
		MAPK signaling pathway - fly	map04013
		TGF-beta signaling pathway	map04350
		Hippo signaling pathway	map04390
		Hippo signaling pathway - fly	map04391
		Sphingolipid signaling pathway	map04071
		PI3K-Akt signaling pathway	map04151
		AMPK signaling pathway	map04152
		Autophagy - animal	map04140
		Autophagy - yeast	map04138
		Autophagy - other	map04136
		Cell cycle - yeast	map04111
		Meiosis - yeast	map04113
		Oocyte meiosis	map04114
		Tight junction	map04530
		Adrenergic signaling in cardiomyocytes	map04261
		Dopaminergic synapse	map04728
		Long-term depression	map04730

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00