Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG3452	8.00E-54	60S ribosomal protein L36
nr	gi\|695065500\|ref\|XP_009421339.1\|	4.22E-65	PREDICTED: 60S ribosomal protein L36-3-like [Musa acuminata subsp. malaccensis]
Swissprot	tr\|Q9LZ57\|RL363_ARATH	2.00E-54	60S ribosomal protein L36-3
trEMBL	tr\|M0RHZ1\|M0RHZ1_MUSAM	2.00E-65	60S ribosomal protein L36 {ECO:0000256\|RuleBase:RU000665}
TAIR	AT5G02450	8.00E-54	Ribosomal protein L36e family protein

Scaffold	Start	End	Strand
GWHAAEX00000014	21419390	21425257	-

Transcript Sequence
>GWHTAAEX000276 ATGGCTCCAGTGCTTCCAAAGTCGGGCCTTTTTGTTGGGCTCAACAAAGGGCATATCGTCACCAAAAGGGAGCTTCCTCCTCGCCCGTCAAGCAGGAAAGGGAAAACTAGCAAGAGGGTTCATTTTGTAAGGAACTTAATCAGGGAAGTTGCCGGGTTTGCTCCTTATGAGAAAAGGATTACTGAGCCTCTGAAAGTCGGGAAGGACAAGCGCGCACTGAAGGTGGCTAAGAGAAAGTTGGGAACGCACAAAAGAGCCAAGAAGAAGAGAGAGGAGATGGCCAATGTTCTCAGGAAGATGAGGTCTGCTGGTGTTTCTGAGAAGAAAAAGTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module8

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K02920	RP-L36e, RPL36	Ribosome	map03010

GO term	Ontology	Name
GO:0006412	Biological Process	translation
GO:0003735	Molecular Function	structural constituent of ribosome
GO:0005840	Cellular Component	ribosome

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	25.840
SRP064423	SRR2545915	Juvenile tuber	45.730
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	12.480
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.610
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.600
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.600
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00