Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|672124806\|ref\|XP_008785801.1\|	8.89E-65	PREDICTED: salt tolerance protein-like isoform X1 [Phoenix dactylifera]
Swissprot	tr\|C0SVM5\|BBX19_ARATH	2.00E-63	B-box zinc finger protein 19 {ECO:0000303\|PubMed:19920209}
trEMBL	tr\|B7ZWS9\|B7ZWS9_MAIZE	2.00E-62	Uncharacterized protein {ECO:0000313\|EMBL:ACL52378.1, ECO:0000313\|EnsemblPlants:GRMZM2G422644_P01}
TAIR	AT2G21320	8.00E-55	B-box zinc finger family protein

Scaffold	Start	End	Strand
GWHAAEX00000008	6377772	6404117	+

Transcript Sequence
>GWHTAAEX000453 ATGCGAATAATCTGCGATGTTTGTGAGAGCGCTCCTGCTGTTCTCTTCTGCGCAGCTGACGAGGCCGCCCTTTGCCGTCCTTGCGATGATAAGGTGCACAAGTGCAACAAACTTGCCAGCCGGCACGTGCGCGTAGAGCTTGCTGATCCGAGTAAAGTTCCCTGTTGCGATATTTGCGAAGTCTCTCCCGCCTTTTTCTATTGCGAAATAGATGGGAGCTCCCTGTGCTTGCAATGCGACACTGTTGTGCACGTGGGGGGAAAGAGAGCTCATGCGAGATACCTGCTATTGAGGCAGAGGGTTGAGTTTCTTCTTCAGCAGCAGCAGCAGAACCATGAGGTCTCTCTCCCTGTATTAATTGTTAACAGCGATGATCATTGCATTGGGGACTCCAAAATGATTGACCTTAACAAGATACCATCCCGAGCTTCCTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module6

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00643.23	zf-B_box	4	45	1.20E-06
PF00643.23	zf-B_box	52	85	7.30E-06

Protein Sequence

Gene family	subfamily
Transcription Factors Family	DBB

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0008270	Molecular Function	zinc ion binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	23.590
SRP064423	SRR2545915	Juvenile tuber	13.640
SRP108465	SRR5643513	five period of Gastrodia elata	16.810
	SRR5643514	five period of Gastrodia elata	25.220
	SRR5643515	five period of Gastrodia elata	11.920
	SRR5643524	five period of Gastrodia elata	20.880
	SRR5643525	five period of Gastrodia elata	74.300
	SRR5643528	five period of Gastrodia elata	55.340
	SRR5643658	five period of Gastrodia elata	77.050
	SRR5643659	five period of Gastrodia elata	10.530
	SRR5643660	five period of Gastrodia elata	11.430
	SRR5643661	five period of Gastrodia elata	13.550
	SRR5643662	five period of Gastrodia elata	11.440
	SRR5643663	five period of Gastrodia elata	16.520
	SRR5643664	five period of Gastrodia elata	14.990
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	38.070
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	18.670
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	44.610
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	53.170
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	74.780
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	99.610
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	62.300
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	75.960
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	33.500
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	58.920
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	34.670
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	34.670
SRP279888	Gastro	Gastrodia elata tuber	20.28
	Juven	Juvenile tuber	21.12
	Mother_Gastro	Mother tuber of Gastrodia elata	52.73
	Mother_Juven	Mother tuber of Juvenile	22.31