Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG0836	1.00E-14	F-actin capping protein, alpha subunit
nr	gi\|695072805\|ref\|XP_009383539.1\|	2.85E-20	PREDICTED: F-actin-capping protein subunit alpha-like [Musa acuminata subsp. malaccensis]
Swissprot	tr\|O82631\|CAPZA_ARATH	4.00E-15	F-actin-capping protein subunit alpha
trEMBL	tr\|M0RRF3\|M0RRF3_MUSAM	1.00E-20	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr11P11730_001}
TAIR	AT3G05520	1.00E-14	Subunits of heterodimeric actin filament capping protein Capz superfamily

Scaffold	Start	End	Strand
GWHAAEX00000008	12205411	12205703	-

Transcript Sequence
>GWHTAAEX000557 ATGGTGGACTGGGGGGGGGAGTCCTTCGATAACCCGGATCTAACTGAGAAGCACAAGAAGGAGATTGCTAAATGGTTTCTCACTAACGCCCCCACCGGAGAGATCCAGTACGTTGCCAAAGGTCGTCCAGATGTTCGGGTGCTAATCGGGGAAGACAGATTGTACAAGATGGCAGCGGCGGAGGCATTTCCCCTTTTCAACAAGGCCCACCTTGTCGTTCTTTAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K10364	CAPZA	Endocytosis	map04144

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	5.090
SRP064423	SRR2545915	Juvenile tuber	13.040
SRP108465	SRR5643513	five period of Gastrodia elata	11.320
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	10.500
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	10.540
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	2.850
	SRR5643660	five period of Gastrodia elata	3.660
	SRR5643661	five period of Gastrodia elata	3.340
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	5.170
	SRR5643664	five period of Gastrodia elata	3.390
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	12.820
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	3.700
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	4.490
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	7.220
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	6.570
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	15.960
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	15.960
SRP279888	Gastro	Gastrodia elata tuber	5.99
	Juven	Juvenile tuber	6.36
	Mother_Gastro	Mother tuber of Gastrodia elata	13.53
	Mother_Juven	Mother tuber of Juvenile	12.40