Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|743853916\|ref\|XP_010940761.1\|	5.67E-12	PREDICTED: transcriptional regulator SUPERMAN-like [Elaeis guineensis]
Swissprot	tr\|Q9SR34\|TAC1_ARATH	3.00E-09	Transcriptional regulator TAC1
trEMBL	tr\|V4TA07\|V4TA07_9ROSI	9.00E-12	Uncharacterized protein {ECO:0000313\|EMBL:ESR57123.1}
TAIR	AT3G53820	5.00E-10	C2H2 and C2HC zinc fingers superfamily protein

Scaffold	Start	End	Strand
GWHAAEX00000103	1341917	1342204	+

Transcript Sequence
>GWHTAAEX001030 ATGGAAGAAATATTAGAGGGCAAGACGAGGGAAGAGGAGCTGAAAGATTCGTGCCAACGAGAGGCGGAGGGATCTGCGGCGTCCCTGTACGACTGCGTTTACTGCAAAATGGGCTTCTCGACGCCTCAGGCATTGGGCGGCCATATGAACATGCACCGGAAGGACCGGTTCGATGTCCGGCCGGCGCCGGCCGAGGATGCGGCCCGTTTCATTCGGACCGGGAAGGAGAAGACGCCCCATAAGTTGGATTTGGAGCTCCGGCTCGGCTGGAGTTCGCACCAGGATTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module2

Gene family	subfamily
Transcription Factors Family	C2H2

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0003676	Molecular Function	nucleic acid binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	1.260
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	31.020
	SRR5643514	five period of Gastrodia elata	44.560
	SRR5643515	five period of Gastrodia elata	15.180
	SRR5643524	five period of Gastrodia elata	37.110
	SRR5643525	five period of Gastrodia elata	5.260
	SRR5643528	five period of Gastrodia elata	6.560
	SRR5643658	five period of Gastrodia elata	8.390
	SRR5643659	five period of Gastrodia elata	0.790
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	16.540
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	55.780
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	25.910
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	16.970
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	42.820
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	23.160
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	21.600
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	15.360
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	35.830
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	30.900
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	86.990
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	86.990
SRP279888	Gastro	Gastrodia elata tuber	0.75
	Juven	Juvenile tuber	0.93
	Mother_Gastro	Mother tuber of Gastrodia elata	3.01
	Mother_Juven	Mother tuber of Juvenile	1.01