Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|672208609\|ref\|XP_008780332.1\|	1.43E-09	PREDICTED: cysteine-rich receptor-like protein kinase 8 [Phoenix dactylifera]
Swissprot	tr\|Q9ZT07\|RKS1_ARATH	5.00E-11	G-type lectin S-receptor-like serine/threonine-protein kinase RKS1 (Precursor)
trEMBL	tr\|W5CMU6\|W5CMU6_WHEAT	3.00E-10	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Traes_3AS_C492FCE9A.1}
TAIR	AT1G11410	2.00E-10	S-locus lectin protein kinase family protein

Scaffold	Start	End	Strand
GWHAAEX00000013	2431108	2431365	+

Transcript Sequence
>GWHTAAEX001482 ATGGCTCCAGAATATCATTTGGACGGCCAGTTCTCAGTTAAGTTTGATGTATATAGTTTTGGTGTGCTGCTTTTAGAGATTGTAACAGGGAGTAGCAGTTGTTCCTTCAATGTTTCACGCTATGTTGGTTTTTCCACGTATGGGAGCATTGGAACAAGGGAAGGATCATAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module4

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KO	Enzyme	pathway	mapID
--	--	--	--

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	4.200
SRP064423	SRR2545915	Juvenile tuber	4.730
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	108.650
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	17.930
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	98.600
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	16.930
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	135.11
	Mother_Gastro	Mother tuber of Gastrodia elata	213.84
	Mother_Juven	Mother tuber of Juvenile	0.00