Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|124502516\|gb\|ABN13632.1\|	2.74E-30	polyphenol oxidase [Doritis pulcherrima x Phalaenopsis hybrid cultivar]
Swissprot	tr\|P43309\|PPO_MALDO	1.00E-22	Polyphenol oxidase, chloroplastic (Precursor)
trEMBL	tr\|A3F9I9\|A3F9I9_9ASPA	1.00E-30	Polyphenol oxidase {ECO:0000313\|EMBL:ABN13632.1}

Scaffold	Start	End	Strand
GWHAAEX00000110	769196	769567	-

Transcript Sequence
>GWHTAAEX001590 ATGACGACTGTCAGGAGGCCAACCGGCGGCAAGGGAGGCGACGTGGTCGAAGTTTTGGTGGTGGATGGGATCGAGTTCGATCGGACGGTGTATACTAAATTTGACGTGTACGTGAACGCGTCGTCGGACGAGGTGACGAAGGGGCAAGCCGTGGCAGAGTGCGCGGGGAGTCTTGCGCACGTGCCGTTCCTACGGCGACATGGCAAGGGAAAAATTGAGATGAAGACGTGCCTCAGGCTGGGGATTGCGGAGCTGCTCAATGATATCGGGGCCGCAGGTGATGATACCGTCGTCGTGACGCTTGTGCCGCGCTGCGGGAAGAAGGTCAAGATTGCTCGAATTTCCATTGAGTTGCTTCCTAACGATCAGTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module2

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K00422	E1.10.3.1	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Tyrosine metabolism	map00350
		Isoquinoline alkaloid biosynthesis	map00950

GO term	Ontology	Name
GO:0055114	Biological Process	oxidation-reduction process
GO:0004097	Molecular Function	catechol oxidase activity

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	1.090
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	7.490
	SRR5643514	five period of Gastrodia elata	35.190
	SRR5643515	five period of Gastrodia elata	7.790
	SRR5643524	five period of Gastrodia elata	28.440
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.580
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	4.920
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	4.360
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	11.760
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	7.800
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	220.640
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	7.880
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	868.740
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	862.750
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	12.380
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	12.380
SRP279888	Gastro	Gastrodia elata tuber	180.31
	Juven	Juvenile tuber	0.82
	Mother_Gastro	Mother tuber of Gastrodia elata	415.32
	Mother_Juven	Mother tuber of Juvenile	4.37