Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|242057865\|ref\|XP_002458078.1\|	1.23E-09	hypothetical protein SORBIDRAFT_03g026625 [Sorghum bicolor]
Swissprot	tr\|Q9M373\|AGP20_ARATH	1.00E-09	Arabinogalactan peptide 20 (Precursor)
trEMBL	tr\|M0U646\|M0U646_MUSAM	2.00E-17	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_AchrUn_randomP03840_001}
TAIR	AT3G61640	4.00E-09	arabinogalactan protein 20

Scaffold	Start	End	Strand
GWHAAEX00000110	1759695	1759883	+

Transcript Sequence
>GWHTAAEX001607 ATGGCAACTTTACGAACCTTTGCTTTGCTCTTCTTCGCAGCTTTTATGCTTTTAGGGATGATGCAGCTTGCTTACGGTCAGCAGTTGCTGAACAAAGCCGTAAGAAAGGTTGATGGAAAGGCAATTGATCAAGGAATAGCTTATGTGCTCATGCTGATTGCTCTTCTTGTTACTTACATTATTCATTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module4

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	16.950
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	80.170
	SRR5643528	five period of Gastrodia elata	21.700
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	12.850
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	25.390
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	10.970
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	49.320
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	18.710
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	22.660
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	8.680
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	8.570
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	11.510
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	11.510
SRP279888	Gastro	Gastrodia elata tuber	30.81
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	409.19
	Mother_Juven	Mother tuber of Juvenile	0.00