Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG1654	1.00E-48	Microtubule-associated anchor protein involved in autophagy and membrane trafficking
nr	gi\|565384885\|ref\|XP_006358352.1\|	1.43E-51	PREDICTED: autophagy-related protein 8f-like [Solanum tuberosum]
Swissprot	tr\|Q8VYK7\|ATG8F_ARATH	1.00E-51	Autophagy-related protein 8f (Precursor)
trEMBL	tr\|M1AXH6\|M1AXH6_SOLTU	5.00E-52	Autophagy-related protein {ECO:0000256\|RuleBase:RU004384}
TAIR	AT3G60640	1.00E-48	Ubiquitin-like superfamily protein

Scaffold	Start	End	Strand
GWHAAEX00000111	3328106	3336562	+

Transcript Sequence
>GWHTAAEX001728 ATGAATGAAAGAAAAGGAGGAAACGATTTGTCTTTTAAGAAGCAAACAATCCGTGCAAGACTTGTTTTGGATGGCGCTGAAAGGCCTTACATTTGCTCGATTGCTCCATCGTTGACTCTTTTAATCTCTTGGGTTTTTGAGATTGCAGCGTTGGAGATGAGTGACAAGATTTTCAGCGGTTCTTACAAGAAAGAACACAGCTTGGAGGCTAGAAAGGAAGAGTCTTCGAGGATTATGAGCAAGTATGAAGATAGGATACCGGTGATAGTGGAGAAAGCACATAGAAGTGACATTCAATGTGTTGACAAGCGCAAATACTTAGTTCCCCGCGACTTAACTGTGGGGCAATTTGCCGGCGTTATCCGCAAGAGAATCAGTTTACCCTCGGAGAAGGCTATGTTTCTTTTTGTGGATAATATTCTTCCTGCCACAGGAGCTTTAATGTCTGAACTATATAATGAGAAGGGAGATGAAGACGGTTTTCTCTACTTTGTCTACAGTGCAGAGAACACTTTTGGCAGATGCTGGTTACAGTATCGTGCTTCTCTTCTTAATCCAGTGTTTTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module4

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K08341	GABARAP, ATG8, LC3	Apelin signaling pathway	map04371
		FoxO signaling pathway	map04068
		Autophagy - animal	map04140
		Autophagy - yeast	map04138
		Autophagy - other	map04136
		Mitophagy - animal	map04137
		Mitophagy - yeast	map04139
		NOD-like receptor signaling pathway	map04621
		GABAergic synapse	map04727
		Longevity regulating pathway - worm	map04212

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	34.340
SRP064423	SRR2545915	Juvenile tuber	41.780
SRP108465	SRR5643513	five period of Gastrodia elata	53.050
	SRR5643514	five period of Gastrodia elata	61.230
	SRR5643515	five period of Gastrodia elata	53.860
	SRR5643524	five period of Gastrodia elata	49.490
	SRR5643525	five period of Gastrodia elata	40.900
	SRR5643528	five period of Gastrodia elata	53.970
	SRR5643658	five period of Gastrodia elata	37.140
	SRR5643659	five period of Gastrodia elata	33.820
	SRR5643660	five period of Gastrodia elata	38.890
	SRR5643661	five period of Gastrodia elata	42.060
	SRR5643662	five period of Gastrodia elata	24.950
	SRR5643663	five period of Gastrodia elata	37.840
	SRR5643664	five period of Gastrodia elata	25.880
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	41.140
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	28.770
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	45.110
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	45.920
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	30.900
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	28.030
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	35.760
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	26.570
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	37.830
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	28.950
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	48.090
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	48.090
SRP279888	Gastro	Gastrodia elata tuber	52.66
	Juven	Juvenile tuber	54.61
	Mother_Gastro	Mother tuber of Gastrodia elata	106.91
	Mother_Juven	Mother tuber of Juvenile	75.31