Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG1696	7.00E-25	60s ribosomal protein L19
nr	gi\|729377170\|ref\|XP_010549573.1\|	7.24E-21	PREDICTED: 60S ribosomal protein L19-3-like, partial [Tarenaya hassleriana]
Swissprot	tr\|Q9LUQ6\|RL192_ARATH	2.00E-25	60S ribosomal protein L19-2
trEMBL	tr\|H9MBV1\|H9MBV1_PINRA	5.00E-21	Uncharacterized protein {ECO:0000313\|EMBL:AEW08597.1} (Fragment)
TAIR	AT3G16780	7.00E-25	Ribosomal protein L19e family protein

Scaffold	Start	End	Strand
GWHAAEX00000116	330777	330959	-

Transcript Sequence
>GWHTAAEX001997 ATGAGGAGGATAGGAGTTTTGAGACGCTTGCTTAGGAAGTATCGGGAAGCAAAGAAAATTGATAAGCACATGTATCATAACATGTATATGAAAGTGAAAGGTAATGTCTTCAAGAACAAGAGAGCCTTGATGGAGAGCATTCACAACTCTAAGGCTGTGAAGCCAAGAGAGAAGACGTTCTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K02885	RP-L19e, RPL19	Ribosome	map03010

GO term	Ontology	Name
GO:0006412	Biological Process	translation
GO:0003735	Molecular Function	structural constituent of ribosome
GO:0005840	Cellular Component	ribosome

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	3.330
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	75.330
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	257.180
	SRR5643528	five period of Gastrodia elata	32.540
	SRR5643658	five period of Gastrodia elata	28.270
	SRR5643659	five period of Gastrodia elata	61.380
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	19.180
	SRR5643664	five period of Gastrodia elata	54.420
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	11.080
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	92.16
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	68.48
	Mother_Juven	Mother tuber of Juvenile	92.82