Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|697118882\|ref\|XP_009613382.1\|	1.46E-11	PREDICTED: arabinogalactan peptide 16-like [Nicotiana tomentosiformis]
Swissprot	tr\|O82337\|AGP16_ARATH	1.00E-12	Arabinogalactan peptide 16 (Precursor)
trEMBL	tr\|M0ZHF3\|M0ZHF3_SOLTU	1.00E-12	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400000846}
TAIR	AT2G46330	5.00E-12	arabinogalactan protein 16

Scaffold	Start	End	Strand
GWHAAEX00000124	1970464	1972149	-

Transcript Sequence
>GWHTAAEX002254 ATGGCAAAGGGAGTGACAAATAAGACTGCAGCTATTATGATGCAAATGAACCGCAGCCTCATTAAGAGTTGGATAATGAAGCATATTTTAGCAATTATATTGATTGGGCTTATTAAGCTCACTAATGGTCAGACAATAACTCCTGCTGCTGCCCCAACGATGAGCAGCGATGGCAAGGCGATTGATCAGGGGATAGCTTATGCGTTGATGATTGCCGCCCTCATTATCACTTATCTAATTCACTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module4

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	13.420
SRP064423	SRR2545915	Juvenile tuber	2.180
SRP108465	SRR5643513	five period of Gastrodia elata	2.170
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	11.940
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	23.660
	SRR5643658	five period of Gastrodia elata	1.860
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	6.860
	SRR5643663	five period of Gastrodia elata	1.460
	SRR5643664	five period of Gastrodia elata	1.870
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	3.130
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	16.740
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	8.140
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	11.850
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	14.460
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	11.570
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	11.530
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	19.820
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	14.990
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	18.870
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	11.110
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	11.110
SRP279888	Gastro	Gastrodia elata tuber	17.93
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	1,345.42
	Mother_Juven	Mother tuber of Juvenile	25.33