Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|743861739\|ref\|XP_010943359.1\|	2.40E-25	PREDICTED: basic leucine zipper 43 [Elaeis guineensis]
Swissprot	tr\|Q9FMC2\|BZP43_ARATH	5.00E-18	Basic leucine zipper 43
trEMBL	tr\|M0U0C7\|M0U0C7_MUSAM	2.00E-24	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr9P14690_001}
TAIR	AT3G30530	4.00E-19	basic leucine-zipper 42

Scaffold	Start	End	Strand
GWHAAEX00000131	1344777	1345349	+

Transcript Sequence
>GWHTAAEX002766 CCTCTCTCTCTCTCTATATATCCTGAAAATGCACTCTTCTAAAATAGCCTCGGCTCACAGCCGCTTCCCTCCGCCGCAAACGGCCACGATCCTCGCCGACGAGCGGCGGCGGCGGCGCATGATTTCGAACCGCGAGTCGGCGAGGAGGTCGCGAATGCGGAAGAAGAGGCAGCTGGACGAACTCCGCTCCCAAGTCTACCACCTCCGATCCATGAACCGCCGACTCCTCGACGAGCTCAACCGGATGATGGCGCAGCAGCACGCAATCCGGCACGAAAATGACAGGCTCAGGGTGGAAGAATGCGAGCTCAAGGAGAGGCTAGCCAAGGCTCAGCAATGCCTCGATGATCATAATGCTATGGGGATGATTTTGGAGGACGTGGATGATGCTCTTGAATCATGCAACGTGGCTCATATGAAAAAGGAAGCGGCTTTGATGTATAATAATAATAATATGACTTCACAATTGGTTTTTCCTTACTGAGAGACATTGAATTCTGATTGTCTGCCTCACTATTTTATTTGTGTTAATTGCTTTGGTGGGCGATAAAGTTAGCATTAATTAGGCGTTTC

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module2

Gene family	subfamily
Transcription Factors Family	bZIP

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0006355	Biological Process	regulation of transcription, DNA-templated
GO:0003700	Molecular Function	transcription factor activity, sequence-specific DNA binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.180
SRP064423	SRR2545915	Juvenile tuber	2.010
SRP108465	SRR5643513	five period of Gastrodia elata	1.800
	SRR5643514	five period of Gastrodia elata	2.270
	SRR5643515	five period of Gastrodia elata	0.560
	SRR5643524	five period of Gastrodia elata	0.980
	SRR5643525	five period of Gastrodia elata	0.210
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	2.610
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.180
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	8.140
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	4.550
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	7.970
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	1.950
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	4.860
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	4.840
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	2.960
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	4.850
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	10.180
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	6.120
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	17.960
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	17.960
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	2.17
	Mother_Gastro	Mother tuber of Gastrodia elata	8.92
	Mother_Juven	Mother tuber of Juvenile	1.33