Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|720068579\|ref\|XP_010277152.1\|	4.83E-19	PREDICTED: probable indole-3-acetic acid-amido synthetase GH3.1 [Nelumbo nucifera]
Swissprot	tr\|O81829\|GH35_ARATH	7.00E-17	Indole-3-acetic acid-amido synthetase GH3.5
trEMBL	tr\|M0SU34\|M0SU34_MUSAM	1.00E-18	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr4P32720_001}
TAIR	AT4G27260	2.00E-16	Auxin-responsive GH3 family protein

Scaffold	Start	End	Strand
GWHAAEX00000129	908870	909391	-

Transcript Sequence
>GWHTAAEX003189 ATTGTTTAATATATATTCTTATGTAAGATGATATTTTTCCACTTCAGTTTAAATTAACCATTAATAGTACCGTTATAATTTCATCTCTTTTTAGCCAGCAAACGTCTCTCATGGCGGAGGCGGCGGCGAAGCAACGCAGCAAAAACGATCCGATCAGCCTCACGCCTGCGGGAGAGCGATGAGGAAAGGCTTATATTCATCGAGCTGATGACCAAAAACTGCGACGAAGTGCAGCAGCAAGTATTGGCCGAGATACTGGAACAGAACAAAGAAACAGAGTATCTCCGCCTCCACGACCTTGGCGGCACCGCTTACCGCGCCTCTTTTAAATCAAAGATTCCGGTCGTCACCTCTGGCACGTCCGGTGGTGAGAGGAAGCTGATGCCGACCACGCAGGACGAGCAGGACCGCGCCTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module3

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K14487	GH3	Plant hormone signal transduction	map04075

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	20.950
SRP064423	SRR2545915	Juvenile tuber	28.680
SRP108465	SRR5643513	five period of Gastrodia elata	3.960
	SRR5643514	five period of Gastrodia elata	10.220
	SRR5643515	five period of Gastrodia elata	7.680
	SRR5643524	five period of Gastrodia elata	12.080
	SRR5643525	five period of Gastrodia elata	3.420
	SRR5643528	five period of Gastrodia elata	1.110
	SRR5643658	five period of Gastrodia elata	7.540
	SRR5643659	five period of Gastrodia elata	18.940
	SRR5643660	five period of Gastrodia elata	22.100
	SRR5643661	five period of Gastrodia elata	13.170
	SRR5643662	five period of Gastrodia elata	13.850
	SRR5643663	five period of Gastrodia elata	40.710
	SRR5643664	five period of Gastrodia elata	27.090
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	9.100
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	2.100
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	4.050
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	4.120
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	1.760
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	2.670
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	3.680
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.620
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.300
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	3.210
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	3.210
SRP279888	Gastro	Gastrodia elata tuber	28.03
	Juven	Juvenile tuber	3.48
	Mother_Gastro	Mother tuber of Gastrodia elata	8.00
	Mother_Juven	Mother tuber of Juvenile	6.24