Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|356520689\|ref\|XP_003528993.1\|	8.08E-29	PREDICTED: protein BASIC PENTACYSTEINE2-like isoformX1 [Glycine max]
Swissprot	tr\|P0DH89\|BBRB_ORYSJ	8.00E-29	Barley B recombinant-like protein B
trEMBL	tr\|F6GSS6\|F6GSS6_VITVI	3.00E-29	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43311.1}
TAIR	AT1G14685	6.00E-27	basic pentacysteine 2

Scaffold	Start	End	Strand
GWHAAEX00000019	4720475	4721472	-

Transcript Sequence
>GWHTAAEX004571 ATGTCGGTTTATCCACTTCCAATGAGCTCTAAGCTCAAAGGGGCTCGAATTGCTGGCCGGAAGATGAGCCTTGGCGCATTTAAGAAGGTTTTGGAGAAGCTTGCCGGGGATGGGCATCAGTTCAAGGATCCGATAGACTTGAAGCTGTTTTGGGCGAAGCATGGAACCAACAAGTTTGTTACAATCAGAACGCTTTGCGCCGGAAAGGAATCCGAGAACCTTGTATTTCCACTGCGCGGCCTCCGCTCCGAGGTCCTTTTCCTTGGCCCCAATTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
Transcription Factors Family	BBR-BPC

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.700
SRP064423	SRR2545915	Juvenile tuber	8.740
SRP108465	SRR5643513	five period of Gastrodia elata	2.460
	SRR5643514	five period of Gastrodia elata	6.100
	SRR5643515	five period of Gastrodia elata	1.130
	SRR5643524	five period of Gastrodia elata	0.910
	SRR5643525	five period of Gastrodia elata	2.230
	SRR5643528	five period of Gastrodia elata	1.310
	SRR5643658	five period of Gastrodia elata	5.050
	SRR5643659	five period of Gastrodia elata	4.690
	SRR5643660	five period of Gastrodia elata	4.440
	SRR5643661	five period of Gastrodia elata	3.220
	SRR5643662	five period of Gastrodia elata	1.220
	SRR5643663	five period of Gastrodia elata	4.130
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	9.070
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	3.130
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	6.830
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	2.910
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	1.670
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	6.310
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	3.700
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	3.560
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	3.560
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	3.53
	Mother_Juven	Mother tuber of Juvenile	2.33