Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|124268566\|ref\|YP_001022570.1\|	3.00E-06	cytochrome [Methylibium petroleiphilum PM1]
KOG	KOG0156	8.00E-21	Cytochrome P450 CYP2 subfamily
nr	gi\|125556224\|gb\|EAZ01830.1\|	2.22E-22	hypothetical protein OsI_23854 [Oryza sativa Indica Group]
Swissprot	tr\|O48923\|C71DA_SOYBN	5.00E-22	Cytochrome P450 71D10
trEMBL	tr\|W5EM15\|W5EM15_WHEAT	9.00E-24	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Traes_4DL_D333973B2.1}
TAIR	AT5G42590	8.00E-21	cytochrome P450, family 71, subfamily A, polypeptide 16

Scaffold	Start	End	Strand
GWHAAEX00000160	948891	949340	+

Transcript Sequence
>GWHTAAEX004901 ATGGAGAATATTACACTGCACTCTGCGATCCTCATTACAACAGTTTTTCTGATCATTGCAGTCCTGCGCAGATCGCGCATGCAGAGGCCCATCAAACTGGCTCCAGGGCCAAAGACACTCCCCATCATTGGAAGCATTCACCATCTCTTCGGCCAGCCCCTTCTCCACCGCGCTCTCCGCAGCCTCTCCAGCATATACGGCCCTGTGATGCGCCTCAGACTGGGCGAGATCGACGCCCTCATCATCTCCTCCGCCGAAGCTGCCAAAGAAGTTATGGCAACCCATGACATGGCTTTCTCTTCGCGTCCCATCACTCCCACGGCCGCATCCTCTTTCCCGCCGGAATCAGCATCGCCTTCAGCCCCTATGGCGACTACTACCGCCAGGTCCGTCGAATTTGTTCCCTCGAACTCCTCAGCCCAGATCGGGTCCGATACTTTAGCAGCCTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
Cytochrome P450 Family	CYP71A16

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0055114	Biological Process	oxidation-reduction process
GO:0020037	Molecular Function	heme binding
GO:0016705	Molecular Function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0005506	Molecular Function	iron ion binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.260
SRP064423	SRR2545915	Juvenile tuber	0.290
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.710
	SRR5643515	five period of Gastrodia elata	0.570
	SRR5643524	five period of Gastrodia elata	0.250
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.250
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	4.660
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.290
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.470
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.470
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.58
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00