Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|743862645\|ref\|XP_010943591.1\|	2.42E-10	PREDICTED: transcriptional regulator SUPERMAN-like [Elaeis guineensis]
Swissprot	tr\|Q9FFX4\|KNU_ARATH	4.00E-06	Zinc finger protein KNUCKLES
trEMBL	tr\|W1PF34\|W1PF34_AMBTC	2.00E-07	Uncharacterized protein {ECO:0000313\|EMBL:ERN06231.1}
TAIR	AT3G53820	3.00E-06	C2H2 and C2HC zinc fingers superfamily protein

Scaffold	Start	End	Strand
GWHAAEX00000166	784000	784425	+

Transcript Sequence
>GWHTAAEX005330 ATGAGTAGGTTCGATCAATTCGACGAGGACATTTACAACTTTTCTTCGAAGGGAACTTCAACACATGTGTGCTCTTATTGTGACAAGAAATATCAAAGTTTACAAGCACTGGGAGGTCATCAGACAGCTCATAGGAAGGAGATTGCAGAAATGAGAAAACAGTATTGTGAGGATCAATTTTCAGGGAACAAGCTTCAAAATAGTGGACAAAGGAACCTCTCTGCCTCTTCTACTGAAAAAAGCTCTATAGTTAATTTAGAACTCACTTTATGTACCAATAATAATAGGTTAGATGGCTTAGATCTGTCTCTAAAGCTCTAACTTAACACACAAATAACATTGTAACACATTTTATAGTTATTAACAAATTAATTACTCAATTTTTATCATAAAAATTATCTCGTTTATAATATTTTCCTATTATTC

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0003676	Molecular Function	nucleic acid binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.570
SRP064423	SRR2545915	Juvenile tuber	3.210
SRP108465	SRR5643513	five period of Gastrodia elata	0.690
	SRR5643514	five period of Gastrodia elata	0.260
	SRR5643515	five period of Gastrodia elata	0.640
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.530
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.310
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.630
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.290
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.13
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00