Gene detail

Detail information of GWHGAAEX005729/evm.TU.scaffold_17.74

Functional Annotation

Database	Orthologs	E value	Annotation
KOG	KOG3173	6.00E-45	Predicted Zn-finger protein
nr	gi\|695048122\|ref\|XP_009411960.1\|	9.27E-53	PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 5-like [Musa acuminata subsp. malaccensis]
Swissprot	tr\|Q9SJM6\|SAP4_ARATH	2.00E-45	Zinc finger A20 and AN1 domain-containing stress-associated protein 4
trEMBL	tr\|M0TNH4\|M0TNH4_MUSAM	3.00E-53	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr8P07710_001}
TAIR	AT2G36320	6.00E-45	A20/AN1-like zinc finger family protein

Location And Transcript Sequence

Scaffold	Start	End	Strand
GWHAAEX00000018	2356305	2356763	+

Transcript Sequence
>GWHTAAEX005729 ATGGCGGAAGAGCGGCGATGCCAAGAAGGCCTTCGATGTGCGAACAACTGCGGGTTCTTTGGAAGCCCGACGACGCTGAACCTCTGCTCCAAGTGCTACCACGATCATCTCAAAACGGAGCAAGATCTGATCGCCGTGGAAAAGTCTCTTCTCTTGCCGGCCTCCTCTTCCATGGTGGCCGCTCTTTCTTCCCTTTCATCGTCCTCTTTCGATGCTGCGGCCCAAGCGCCGGCAGAGGCCGCCGTCGAACTGCCGGAGGCCGAGGGGCCGAAGCGGTGCACGGCCTGCCGGAAAAAGATCGGGCTAACGGGTTTCAGGTGCAGGTGCGGGTCGACCTTCTGCGGGTCCCACAGGTACCCGGAAAAACACTCCTGCGGCTTCGATTACAAGGCTGCCGGCCGTGAAGCCATCGCCCGATCGAACCCCATCGTGCAGGCCGATAAGCTGCGAAAGATCTAG

Network for GWHGAAEX005729

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
Module4

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01754.15	zf-A20	11	34	6.00E-12
PF01428.15	zf-AN1	93	130	4.60E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0008270	Molecular Function	zinc ion binding
GO:0003677	Molecular Function	DNA binding

Expression pattern

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	134.680
SRP064423	SRR2545915	Juvenile tuber	210.110
SRP108465	SRR5643513	five period of Gastrodia elata	125.540
	SRR5643514	five period of Gastrodia elata	96.260
	SRR5643515	five period of Gastrodia elata	208.880
	SRR5643524	five period of Gastrodia elata	85.120
	SRR5643525	five period of Gastrodia elata	571.400
	SRR5643528	five period of Gastrodia elata	401.060
	SRR5643658	five period of Gastrodia elata	370.780
	SRR5643659	five period of Gastrodia elata	257.930
	SRR5643660	five period of Gastrodia elata	198.890
	SRR5643661	five period of Gastrodia elata	298.510
	SRR5643662	five period of Gastrodia elata	380.990
	SRR5643663	five period of Gastrodia elata	225.670
	SRR5643664	five period of Gastrodia elata	754.250
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	367.470
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	146.450
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	249.190
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	310.320
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	324.430
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	359.230
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	419.650
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	320.960
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	184.210
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	344.820
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	298.760
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	298.760
SRP279888	Gastro	Gastrodia elata tuber	259.01
	Juven	Juvenile tuber	131.97
	Mother_Gastro	Mother tuber of Gastrodia elata	1,173.45
	Mother_Juven	Mother tuber of Juvenile	368.98