Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG0951	9.00E-20	RNA helicase BRR2, DEAD-box superfamily
nr	gi\|670445695\|ref\|XP_008663117.1\|	4.16E-21	PREDICTED: U5 small nuclear ribonucleoprotein 200 kDa helicase-like [Zea mays]
Swissprot	tr\|Q0WT48\|DNJ21_ARATH	4.00E-20	DnaJ protein ERDJ2A
trEMBL	tr\|K7TJM1\|K7TJM1_MAIZE	4.00E-21	Uncharacterized protein {ECO:0000313\|EMBL:AFW57973.1, ECO:0000313\|EnsemblPlants:GRMZM2G009346_P01}
TAIR	AT1G79940_2	9.00E-20	Unannotated protein

Scaffold	Start	End	Strand
GWHAAEX00000176	1557485	1557685	-

Transcript Sequence
>GWHTAAEX005943 ATGTCCACCCACTGGATTTCCCTCAGGAGCAGCAATGGCCTCGTAGCCGAACTTCCTCATTGCCCTTACTTCCCGTTCCGCAAAGAGGAAAGCTTCCGGGTGCTTCTGGCCGATGAGGAGGCCAACGATGTGTGGATGTCTCAGAAGATCTCTTCCATGGACGAGGAGAGCGCCCTCGCTGCAGCATCCCGCGAGGTTTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module1

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K09540	SEC63, DNAJC23	Protein export	map03060
K09540	SEC63, DNAJC23	Protein processing in endoplasmic reticulum	map04141

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	27.940
	SRR5643514	five period of Gastrodia elata	9.750
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	18.910
	SRR5643525	five period of Gastrodia elata	107.430
	SRR5643528	five period of Gastrodia elata	11.140
	SRR5643658	five period of Gastrodia elata	18.670
	SRR5643659	five period of Gastrodia elata	7.220
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	8.570
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	13.310
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	9.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	13.890
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	6.610
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	12.990
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	12.990
SRP279888	Gastro	Gastrodia elata tuber	18.38
	Juven	Juvenile tuber	18.52
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00