Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG2770	2.00E-09	Aminomethyl transferase
nr	gi\|720073199\|ref\|XP_010278627.1\|	1.11E-09	PREDICTED: aminomethyltransferase, mitochondrial-like [Nelumbo nucifera]
Swissprot	tr\|P54260\|GCST_SOLTU	1.00E-10	Aminomethyltransferase, mitochondrial (Precursor)
trEMBL	tr\|E5GC65\|E5GC65_CUCME	7.00E-10	Aminomethyltransferase {ECO:0000256\|RuleBase:RU003981}
TAIR	AT1G11860	2.00E-09	Glycine cleavage T-protein family

Scaffold	Start	End	Strand
GWHAAEX00000183	427878	428681	-

Transcript Sequence
>GWHTAAEX006008 ATGTTTAGATTTGCCGCCTCTGATGAGCTTAAGAAAACCTCTCTTCACGGTTTCCATATCGAGAGTTCCATTTGCCGGATGGAGTATGTCGATTCAGTACAGAGAACCCTTTTCGATGTCTCCATCTGCAGCCTCAGCCTCACCGGAAAGGACTCAATGCCCTTCCTCGAGCGCCTGGTCGTTGCTATTGTCGCCGATCTCCTCCTCGGCATGGGAAAGGACTCCGTGCCCTTCCCTTCTTCGAGCTCCCTCTTCTACGATTTTTGTTGCTTTTAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module11

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K00605	gcvT, AMT	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of antibiotics	map01130
		Carbon metabolism	map01200
		Glyoxylate and dicarboxylate metabolism	map00630
		Pyrimidine metabolism	map00240
		One carbon pool by folate	map00670

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	2.100
SRP064423	SRR2545915	Juvenile tuber	0.790
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	1.020
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	2.730
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	1.010
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	2.220
	SRR5643661	five period of Gastrodia elata	3.220
	SRR5643662	five period of Gastrodia elata	1.220
	SRR5643663	five period of Gastrodia elata	3.310
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	11.420
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	1.190
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	1.190
SRP279888	Gastro	Gastrodia elata tuber	6.14
	Juven	Juvenile tuber	1.25
	Mother_Gastro	Mother tuber of Gastrodia elata	0.98
	Mother_Juven	Mother tuber of Juvenile	6.00