Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|222150771\|ref\|YP_002559924.1\|	5.00E-09	glyceraldehyde-3-phosphate dehydrogenase [Macrococcus caseolyticus JCSC5402]
KOG	KOG0657	1.00E-15	Glyceraldehyde 3-phosphate dehydrogenase
nr	gi\|730046238\|gb\|AIZ07788.1\|	6.62E-15	glyceraldehyde 3-phosphate dehydrogenase, partial [Gymnadenia conopsea]
Swissprot	tr\|P17878\|G3PC_MESCR	4.00E-16	Glyceraldehyde-3-phosphate dehydrogenase, cytosolic
trEMBL	tr\|A0A067YI00\|A0A067YI00_HORVS	4.00E-15	Glyceraldehyde-3-phosphate DH {ECO:0000313\|EMBL:AHC54505.1} (Fragment)
TAIR	AT1G13440	1.00E-15	glyceraldehyde-3-phosphate dehydrogenase C2

Scaffold	Start	End	Strand
GWHAAEX00000015	2291263	2294569	+

Transcript Sequence
>GWHTAAEX006316 ATGGTTCAGTCGGTTTCAGCTGGAGGTTGTTCAATGATGGCATCATTGGAAATGGAAATAGGGTCGGCCATCATCGAGGGATCGATGAGGATGAGGCTACAAAGCTTCTATCGCTCTAATACCATAAATCCTGAGGAGATCCCGTGGGGTGAGGCTGGAGCTGATTTTGTTGTTGAGTCCACCGGTGTTTTTACTGATAAGGACAAGGCTGCTGCTCATTTGAAGGACGCTAAGGCACCGAGGAAGAGCATGGGCGCTAATGTGCGCTCCAGCGCCAGCCTGACAGAAACTAGGCACTCGGGTGCACCCGAGTGCCAGCTTGACAAAAACTTGGGTGCACAAGCATACCCAGACGCCAAAGAGGCAGATACTCGTGCGCTCTAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K00134	GAPDH, gapA	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Biosynthesis of antibiotics	map01130
		Carbon metabolism	map01200
		Biosynthesis of amino acids	map01230
		Glycolysis / Gluconeogenesis	map00010
		Carbon fixation in photosynthetic organisms	map00710
		HIF-1 signaling pathway	map04066

GO term	Ontology	Name
GO:0055114	Biological Process	oxidation-reduction process
GO:0016620	Molecular Function	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00