Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|389873647\|ref\|YP_006381066.1\|	9.00E-16	NAD(P)H:quinone oxidoreductase [Advenella kashmirensis WT001]
KOG	KOG3135	1.00E-29	1,4-benzoquinone reductase-like; Trp repressor binding protein-like/protoplast-secreted protein
nr	gi\|661896492\|emb\|CDO99681.1\|	6.15E-30	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9LSQ5\|FQR1_ARATH	4.00E-30	NAD(P)H dehydrogenase (quinone) FQR1 {ECO:0000305}
trEMBL	tr\|A0A068TTZ3\|A0A068TTZ3_COFCA	2.00E-30	Coffea canephora
TAIR	AT5G54500	1.00E-29	flavodoxin-like quinone reductase 1

Scaffold	Start	End	Strand
GWHAAEX00000020	1126132	1127347	-

Transcript Sequence
>GWHTAAEX006725 ATGCATGTTTCTAGATTGACTGCCATCACTCAGTTGACACATCATGGGATGATATACGTGCCGATCGGATACACGGCCGGCGCCATTATGTTTGAAGTGGAGGAGGTGAAGGGTGGGTCTCCGTACGGTGCGGGAACAATTGCAGGAGATGGATCAAGGCAGCCTTCTGAGCTAGAGCTCCAGATTGCGTTTCATCAGCCTGTTGCCTCTGCTGTTGCTTGGACTGCTGGCAGCTATTGCTTGGGCTGTTGGCTACTAATGCTTGGGCTATTGGCAACTACTGCTTTTATTGCTGCTATGGTTGCTGGCTGCTACTGCTTGGGCTATTGGCAGCTGCCTCTGTTGTTGCTTTCAATATGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K03809	wrbA	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Ubiquinone and other terpenoid-quinone biosynthesis	map00130

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.400
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	3.870
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	10.520
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	1.650
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.480
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.560
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	1.320
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	1.020
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	1.410
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	2.300
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	2.300
SRP279888	Gastro	Gastrodia elata tuber	0.48
	Juven	Juvenile tuber	0.24
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00