Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|336324085\|ref\|YP_004604052.1\|	7.00E-32	flavoprotein WrbA [Flexistipes sinusarabici DSM 4947]
KOG	KOG3135	4.00E-50	1,4-benzoquinone reductase-like; Trp repressor binding protein-like/protoplast-secreted protein
nr	gi\|643731804\|gb\|KDP38996.1\|	4.39E-52	hypothetical protein JCGZ_00753 [Jatropha curcas]
Swissprot	tr\|Q6NQE2\|FQRL1_ARATH	4.00E-51	Probable NAD(P)H dehydrogenase (quinone) FQR1-like 1 {ECO:0000305}
trEMBL	tr\|A0A067KRZ3\|A0A067KRZ3_JATCU	2.00E-52	Uncharacterized protein {ECO:0000313\|EMBL:KDP38996.1}
TAIR	AT5G54500	4.00E-50	flavodoxin-like quinone reductase 1

Scaffold	Start	End	Strand
GWHAAEX00000020	1127481	1131788	-

Transcript Sequence
>GWHTAAEX006726 ATGATCAAAAGACAAAAAAATCTTATTAGATTTGAAGAAAGATTACATAATTTGGGAGAACAAATATACACACCAATTACTGTTTCTTACCTTAGGTATTACTCCACTTACGGGCATGTTGAGACACTAGCTCGAGAGATTTTGAAGGGGGCCTCATCAGTCGAAGGAGTGGAAGCTAAGCTGTGGCAGGTTCCTGAGACACTCTCACAAGAAGGCCTCAGCAAATTGGGCGCGCCGCCGAAGAGTGCCGATGTTCCGGTCATCGAGCCCGACAAGCTCCCGGAAGCCGACGGGCTAATCTTCGGATTCCCCACCAGATTCGGAATGATGGCTGCTCAATTTAAAGCATTCTTAGATTCTACAGGCGGCCTCTGGAAAACTCAGCAGCTTGCTGGATAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module6

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K03809	wrbA	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Ubiquinone and other terpenoid-quinone biosynthesis	map00130

GO term	Ontology	Name
GO:0010181	Molecular Function	FMN binding
GO:0016491	Molecular Function	oxidoreductase activity

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.640
SRP064423	SRR2545915	Juvenile tuber	0.360
SRP108465	SRR5643513	five period of Gastrodia elata	0.400
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.480
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.320
	SRR5643660	five period of Gastrodia elata	0.350
	SRR5643661	five period of Gastrodia elata	2.120
	SRR5643662	five period of Gastrodia elata	0.360
	SRR5643663	five period of Gastrodia elata	1.340
	SRR5643664	five period of Gastrodia elata	2.300
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	7.030
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	17.310
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	3.970
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	11.990
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	6.720
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	5.420
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	10.140
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	11.050
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	3.470
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	1.360
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	2.320
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	2.320
SRP279888	Gastro	Gastrodia elata tuber	2.62
	Juven	Juvenile tuber	1.34
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00