Gene detail

Detail information of GWHGAAEX007347/evm.TU.scaffold_2.159

Functional Annotation

Database	Orthologs	E value	Annotation
COG	gi\|428320931\|ref\|YP_007118813.1\|	3.00E-13	putative signal transduction protein with EFhand domain [Oscillatoria nigro-viridis PCC 7112]
KOG	KOG0027	6.00E-42	Calmodulin and related proteins (EF-Hand superfamily)
nr	gi\|743794682\|ref\|XP_010924236.1\|	1.81E-62	PREDICTED: probable calcium-binding protein CML36 [Elaeis guineensis]
Swissprot	tr\|Q9SS31\|CML36_ARATH	2.00E-42	Probable calcium-binding protein CML36
trEMBL	tr\|M0TLB3\|M0TLB3_MUSAM	1.00E-57	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr8P00110_001}
TAIR	AT3G10190	6.00E-42	Calcium-binding EF-hand family protein

Location And Transcript Sequence

Scaffold	Start	End	Strand
GWHAAEX00000010	7213032	7213589	+

Transcript Sequence
>GWHTAAEX007347 ATGAAGCTCGTCAAATTCGGATCCTTGTTCTCGAAGATTTCCAGATCGACGAAAAGGCAGCGGAGCGAATCCCCCTCTTTCGCCTCCTCTTCCGAAGACGCCATCACCCCCAAATCCGTTCTCCCGGTCGCCATCGGCGACCTCTTCAGCTTCTTCGATCGGGACGGTGACGGAAAGATCTCGAAGCCTGAACTAGAGGCCGTGCTCCGGCGGCTCGGCCCCCGCGATCCTCCGACCGAGGAGGAGCTGGCATCCATCGTCGCTGAGATCGATCGAGACGGAGATGGATGCATCAGCTTAAACGAGCTCGAAGCCATCGGCCCGATCGCCCTCGGCGAGGACGCCGCCGGCGATGAGCTCCGTGACGCCTTTTCCGTCTTCGATGCTGACGGAGATGGGCAGATCTCCGCCGAAGAACTTCTCGGAGTCTTTACTGCCTTGGGAGATCGCGAATGCACCGTCGAAGATTGCCGGAGGATGATCCTCGGAGTCGATAGCGTCGGCAATGGGTTTGTGTGCTTTAGAGATTTCGTGAGGATGATGGACGGACAGAGATGA

Network for GWHGAAEX007347

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
Module4

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.5	EF-hand_7	45	105	1.40E-13
PF13202.5	EF-hand_5	120	141	7.60E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	Molecular Function	calcium ion binding

Expression pattern

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	119.530
SRP064423	SRR2545915	Juvenile tuber	89.730
SRP108465	SRR5643513	five period of Gastrodia elata	172.390
	SRR5643514	five period of Gastrodia elata	84.710
	SRR5643515	five period of Gastrodia elata	172.700
	SRR5643524	five period of Gastrodia elata	112.780
	SRR5643525	five period of Gastrodia elata	364.230
	SRR5643528	five period of Gastrodia elata	262.070
	SRR5643658	five period of Gastrodia elata	184.800
	SRR5643659	five period of Gastrodia elata	298.720
	SRR5643660	five period of Gastrodia elata	163.830
	SRR5643661	five period of Gastrodia elata	198.430
	SRR5643662	five period of Gastrodia elata	258.220
	SRR5643663	five period of Gastrodia elata	149.310
	SRR5643664	five period of Gastrodia elata	582.720
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	590.320
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	236.180
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	507.450
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	509.100
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	546.790
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	657.570
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	578.040
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	554.520
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	282.440
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	425.160
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	465.820
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	465.820
SRP279888	Gastro	Gastrodia elata tuber	296.95
	Juven	Juvenile tuber	73.79
	Mother_Gastro	Mother tuber of Gastrodia elata	753.98
	Mother_Juven	Mother tuber of Juvenile	376.82