Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|325280278\|ref\|YP_004252820.1\|	3.00E-10	Glycine hydroxymethyltransferase [Odoribacter splanchnicus DSM 220712]
KOG	KOG2467	8.00E-31	Glycine/serine hydroxymethyltransferase
nr	gi\|604320567\|gb\|EYU31509.1\|	4.08E-33	hypothetical protein MIMGU_mgv1a021252mg, partial [Erythranthe guttata]
Swissprot	tr\|O23254\|GLYC4_ARATH	2.00E-31	Serine hydroxymethyltransferase 4
trEMBL	tr\|M0TWL9\|M0TWL9_MUSAM	3.00E-40	Serine hydroxymethyltransferase {ECO:0000256\|RuleBase:RU000585}
TAIR	AT4G13930	8.00E-31	serine hydroxymethyltransferase 4

Scaffold	Start	End	Strand
GWHAAEX00000026	6442012	6443642	+

Transcript Sequence
>GWHTAAEX007622 ATGGTGTCAAACGTGCAAGCCAGACGACATGAAGTTAATAATCCATTTGAGCACTGTGACGTCGTCACAACGACAACCCATAAGAGTCTTAGAGGTCCAAGATCCGGCATGAATTTCTACAGGAAGGGCCCGAAGCCGCCCAAGAAGGGACAGCCCGAGAACGTTGTTTGCGAATTTGAAGACAAGATAAACTTTGCAATTTTTCCTTCACTCCAGGTGTTTGGAGACAGCAGTGCTTTGGCTCCCGACGGTGTCCGGATAGGTGCTCCTGCCATGACTTCAAGGAGACTTGTGGAGAAGGATTTTGAGCAGATTGCAGAGTTTCTGCACCAAGCAGTGACCATCACGCTCAGCATCCAGAAGGAGCATGGGAAGCTTCTCAAGGACTTCAATAAAGGTCTGGCGAACAATGAGAGCAGATATAAACTTGATGCAAATGTAAGATTTAAATTATTTGTTGAATATATGCTTGTCATGCACTTTGTTGGGGTTTCGAAGCAATAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00464.18	SHMT	12	72	1.90E-18
PF00464.18	SHMT	74	108	6.00E-07

Protein Sequence

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K00600	glyA, SHMT	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Biosynthesis of antibiotics	map01130
		Carbon metabolism	map01200
		Biosynthesis of amino acids	map01230
		Glyoxylate and dicarboxylate metabolism	map00630
		Methane metabolism	map00680
		Pyrimidine metabolism	map00240
		Cyanoamino acid metabolism	map00460
		One carbon pool by folate	map00670

GO term	Ontology	Name
GO:0003824	Molecular Function	catalytic activity
GO:0030170	Molecular Function	pyridoxal phosphate binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.27