Gene detail

Detail information of GWHGAAEX008665/evm.TU.scaffold_227.40

Functional Annotation

Database	Orthologs	E value	Annotation
COG	gi\|206901413\|ref\|YP_002250709.1\|	2.00E-07	ribosomal protein L29 [Dictyoglomus thermophilum H-6-12]
KOG	KOG3436	2.00E-68	60S ribosomal protein L35
nr	gi\|728820943\|gb\|KHG04036.1\|	4.99E-72	60S ribosomal L35 [Gossypium arboreum]
Swissprot	tr\|Q9M5L0\|RL35_EUPES	4.00E-73	60S ribosomal protein L35
trEMBL	tr\|M5X1K6\|M5X1K6_PRUPE	2.00E-72	Uncharacterized protein {ECO:0000313\|EMBL:EMJ19804.1}
TAIR	AT5G02610	2.00E-68	Ribosomal L29 family protein

Location And Transcript Sequence

Scaffold	Start	End	Strand
GWHAAEX00000241	591702	595569	+

Transcript Sequence
>GWHTAAEX008665 ATGGCTAGGATTAAGGTTCACGAACTTCGGCAGAAGACGAAGACGGAGCTTCTCAACCAACTGAATGATCTAAAAGCGGAACTCGCTCTCCTCCGCGTGGCGAAGGTCACCGGAGGTGCTCCCAACAAGCTCTCAAAGATAAAAATTGTGAGGCTCTCGATTGCGCAAGTGCTGACGGTGATATCCCAGAAGCAAAAGGCGGCGTTGAGGGAGGCTTACAGGAAGAAAAAGTTCATTCCGCTTGATCTGAGGCCGAAGAAAACCCGGGCTATAAGGCGTCGGCTTACCAAACGCCAGGCATCACTGAAGACTGAGCGGCAGAAGAAAAAGGAGATGTATTTTCCGTTGAGGAAGTATGCCATCAAAGCGTAG

Network for GWHGAAEX008665

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
Module11

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00831.22	Ribosomal_L29	8	64	6.50E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02918	RP-L35e, RPL35	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	Biological Process	translation
GO:0003735	Molecular Function	structural constituent of ribosome
GO:0005840	Cellular Component	ribosome

Expression pattern

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	855.910
SRP064423	SRR2545915	Juvenile tuber	928.180
SRP108465	SRR5643513	five period of Gastrodia elata	1381.830
	SRR5643514	five period of Gastrodia elata	1461.550
	SRR5643515	five period of Gastrodia elata	1210.360
	SRR5643524	five period of Gastrodia elata	1238.450
	SRR5643525	five period of Gastrodia elata	1251.450
	SRR5643528	five period of Gastrodia elata	925.570
	SRR5643658	five period of Gastrodia elata	877.370
	SRR5643659	five period of Gastrodia elata	1617.940
	SRR5643660	five period of Gastrodia elata	1876.570
	SRR5643661	five period of Gastrodia elata	1822.160
	SRR5643662	five period of Gastrodia elata	1902.880
	SRR5643663	five period of Gastrodia elata	1700.080
	SRR5643664	five period of Gastrodia elata	2071.460
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	1791.630
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	2725.740
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	1915.080
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	1662.870
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	1871.360
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	1812.960
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	1671.370
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	1744.090
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	2140.610
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	2235.990
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	2285.770
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	2285.770
SRP279888	Gastro	Gastrodia elata tuber	4,988.03
	Juven	Juvenile tuber	3,833.43
	Mother_Gastro	Mother tuber of Gastrodia elata	1,939.16
	Mother_Juven	Mother tuber of Juvenile	1,903.03