Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG1087	4.00E-06	Cytosolic sorting protein GGA2/TOM1
nr	gi\|695059233\|ref\|XP_009417967.1\|	1.30E-10	PREDICTED: target of Myb protein 1-like [Musa acuminata subsp. malaccensis]
trEMBL	tr\|A0A096TMY0\|A0A096TMY0_MAIZE	6.00E-10	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GRMZM2G410782_P02}
TAIR	AT4G32760	4.00E-06	ENTH/VHS/GAT family protein

Scaffold	Start	End	Strand
GWHAAEX00000227	736753	738996	+

Transcript Sequence
>GWHTAAEX009025 ATGATGCCGGCTATGATGTCGACTCCGTCGTCTTCCTTATCGGCGACGGTGAGAGTTGAGAAGGCGACGAGCCATCTCTTGATGATTCCGGACTGGACGATGAACATGGATATCTGTGATGCCATCAACACCGACCCATTACATCTGGGATTCGATTTCCCCAACACGAAAAGGATGCAGCTCTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module9

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0006886	Biological Process	intracellular protein transport

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	27.190
SRP064423	SRR2545915	Juvenile tuber	30.830
SRP108465	SRR5643513	five period of Gastrodia elata	20.920
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	100.840
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	22.780
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	15.590
	SRR5643664	five period of Gastrodia elata	21.970
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	41.730
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	36.040
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	21.660
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	20.220
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	12.510
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	51.300
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	38.080
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	47.030
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	6.210
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	6.210
SRP279888	Gastro	Gastrodia elata tuber	209.30
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	169.94
	Mother_Juven	Mother tuber of Juvenile	0.00