Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|85373572\|ref\|YP_457634.1\|	7.00E-11	syrP protein [Erythrobacter litoralis HTCC2594]
nr	gi\|586779337\|ref\|XP_006858502.1\|	1.53E-36	hypothetical protein AMTR_s00071p00132190 [Amborella trichopoda]
Swissprot	tr\|Q9LIG0\|Y3136_ARATH	1.00E-21	Clavaminate synthase-like protein At3g21360
trEMBL	tr\|U5DBR7\|U5DBR7_AMBTC	6.00E-37	Uncharacterized protein {ECO:0000313\|EMBL:ERN19969.1}
TAIR	AT3G21360	4.00E-21	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein

Scaffold	Start	End	Strand
GWHAAEX00000021	2434617	2434934	+

Transcript Sequence
>GWHTAAEX009215 ATGACATCATGTAGCTCAATTAAATTCTATAGTGATGGAAGTGCGGATCTAATTTTTGGCCCTATGAATCCAATAAAAGAGATTGGAGGGAAACGAGTTTGGTTTACTACATTACTGGGATACACAGAGAATAGTAATGATATAAAGAGGGCTTATGGGGATGGAAGTGCTTTCTCTTCAGAGGCTCTTGATACATTTACTAAGATACTAAATGAGAATTGTGTTGACATAAAATGGCAAAAAGGAGATGTGTTAATGATAGACAACTTTGTTGTTCAACATGCAAGGAAGCCTGGAAAGCCACCACGACGTGTGCTT

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module6

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0055114	Biological Process	oxidation-reduction process
GO:0016491	Molecular Function	oxidoreductase activity

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	6.510
SRP064423	SRR2545915	Juvenile tuber	1.700
SRP108465	SRR5643513	five period of Gastrodia elata	10.190
	SRR5643514	five period of Gastrodia elata	5.190
	SRR5643515	five period of Gastrodia elata	2.680
	SRR5643524	five period of Gastrodia elata	2.790
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	1.210
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	22.070
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	30.010
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	24.070
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	7.530
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	42.270
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	36.820
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	9.280
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	23.720
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	40.110
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	37.820
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	32.400
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	32.400
SRP279888	Gastro	Gastrodia elata tuber	17.41
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	19.16
	Mother_Juven	Mother tuber of Juvenile	0.00