Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|262196624\|ref\|YP_003267833.1\|	2.00E-26	RNP-1 like RNA-binding protein [Haliangium ochraceum DSM 14365]
KOG	KOG0118	7.00E-42	FOG: RRM domain
nr	gi\|672141631\|ref\|XP_008794650.1\|	3.19E-50	PREDICTED: glycine-rich RNA-binding protein 4, mitochondrial-like [Phoenix dactylifera]
Swissprot	tr\|Q9SVM8\|RBG2_ARATH	2.00E-42	Glycine-rich RNA-binding protein 2, mitochondrial (Precursor)
trEMBL	tr\|P93486\|P93486_PEA	1.00E-46	Glycine-rich RNA-binding protein PsGRBP {ECO:0000313\|EMBL:AAB71417.1}
TAIR	AT4G13850	7.00E-42	glycine-rich RNA-binding protein 2

Scaffold	Start	End	Strand
GWHAAEX00000030	2392391	2393310	-

Transcript Sequence
>GWHTAAEX009482 ATGGCGCTTTACAGTAAATTTGGCTGCTTAATTCGGCAAGGCATTTCAAATTCTTCTAGCAAATCAGCTTCCATGATACCTATGCTTAATGCTCTCCGCTATTTTTCGACCTCAAAGCTTTTCGTTGGTGGTCTTTCATACGGCACGGATGACATGTCGCTTAAGGAGGCATTCAACTGTTTTGGAACAGTTATTGAAGCAAAGGTTATCATTGATAGGGACACTGGAAGGTCCAAAGGGTTTGGTTTCGTAAATTTTGAAGATTTGGAGTCTGCTAAAAGTGCTGCTTCGAGCATGGACGGCCAGGAACTTAATGGCCGAAACATTCGTGTGAACTTCGCAAATGATAGACCTTCCGCTGGGTTTCGCGGGGGCTATAGCGGCGGCGACGGCGGAGGTGGATTTGGAGGATCGGGTGGGTATTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0003676	Molecular Function	nucleic acid binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	53.170
SRP064423	SRR2545915	Juvenile tuber	60.400
SRP108465	SRR5643513	five period of Gastrodia elata	77.420
	SRR5643514	five period of Gastrodia elata	78.850
	SRR5643515	five period of Gastrodia elata	79.460
	SRR5643524	five period of Gastrodia elata	68.050
	SRR5643525	five period of Gastrodia elata	35.560
	SRR5643528	five period of Gastrodia elata	36.320
	SRR5643658	five period of Gastrodia elata	30.670
	SRR5643659	five period of Gastrodia elata	103.550
	SRR5643660	five period of Gastrodia elata	117.540
	SRR5643661	five period of Gastrodia elata	108.180
	SRR5643662	five period of Gastrodia elata	111.750
	SRR5643663	five period of Gastrodia elata	103.020
	SRR5643664	five period of Gastrodia elata	101.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	92.170
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	41.750
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	93.700
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	98.240
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	76.970
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	63.260
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	67.250
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	71.180
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	90.780
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	73.850
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	124.760
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	124.760
SRP279888	Gastro	Gastrodia elata tuber	125.20
	Juven	Juvenile tuber	100.16
	Mother_Gastro	Mother tuber of Gastrodia elata	32.75
	Mother_Juven	Mother tuber of Juvenile	42.55